Description :
From Genome Similarity Track
Location :
contig_191:40- 2993
Transcript NameFunction/comments
g14117.t1XP_009846822.1 hypothetical protein H257_19374 [Aphanomyces astaci

Sequence
2953 bases(100 bases per row)
TCGTTTCGCTCAATCAAATGGGCGAACTTGGCCTTGTCGTTGCAGATGTGGTGCGTTGCGCCGCTGTCGACCGCCCACATGCCGAGCATATCCTTGCCCG
TCGAAATGCCACACTCCAGTGAGACCGCGAACGCCACTCGATCATAGCCGTAGCCGTAGTCGTAGCTGGCGTCGTCGTTCCTCCACTGGGCATTGTTGGC
CCCGCGTCCACGGCCATTGCCATTGCCGCCGCGTCTTGGGCCCCGATTCTCGTCCTTCTGCTTGGTCCAGCACTTGTCGATCGTGTGCCCCAATTTCCCG
CAGTACGTGCACTGGCGAGACTCTCGGTCGGTGTTGAACGCCTTGGCCGCGTCCTCCGTCTTCACCGTCGCCGTCTTCTCGCCTTGCCGCTTGATGTGCT
CATTCGTCAGCACCTTCACGACGTCTTGCGATCGCAGCTCAGCGCTGCTCATCTCCAAGTTCAGCACGACGTTCTCGTAGCTCTTGGGGAGACTGCGCAA
CAGGCAGATCGCCACGTCCTCGTCCTCCATCTTGGCGCCGATGCTGCTGAGCTTGGCGCTGATGTTGAGGACCTCGTTGCAGTGATGCAACACGTTCCCG
CCTTCCGACATCTCCATGCTGAAGAGTTGGCGCTTCAGGTAGATGCGACCAGCCTTCTGCGAACCACCGTACAGCGTCTTCAGGCGCGTCCACGCAACCC
ACGCTTCCTCGCAGTCGTCGACCACATGGTGGTAGTCCGCGTCCATGTGGAGCAACATCAGTCCGAACGCGATGTTGCTCGACTTGACGTACTCGTCCTT
GGGCCGCGAGTCCGTGAAGCTCGGCGTCGTCTCTCGGTTCACGACATGCCACACCGACTTGGTCAGGAACACGCCACGCATGTAGCGGTTCCACGTCGCG
TAGTTGTCTCCGTTGAACTTGTCGATGGAGACCTTGGTGGAGGCGTCGTGGGCAGAGGACATGGTGCTTGGGCTCATAACCTGATGGAAGGTATGGATCT
TGGACACCGAAGCTTGACGGAGCGGAGGGAGGGCAGCACTCTGGGCGAGACCGGAGCGGAGACTGGAAACCACTTGAGGGGTAGAACGAAGATTCGAAAG
TGATTGATTGAGGTCTTTAGCTCGCTAGCCTTCTCGCTACTCTAGACCTACTGGATACACACTACTTGATTCTTTACTGGATACTGAGTTACTTCAGCCA
ATGAGAGAGCGCCACGTCGAAGCCCATCTTGTACCTACAATCTTGTACCCACAGGTGGCGTAATCGACAGTGGCGTAATCGTCGGTGGCGTAATCGGCGT
GGGTTCGGATTGGACCGGTTCGGGTTAACCGGTTCACGGTCAACAACCGATACCAAACCGGTAACCCTCAATAGGCTTCAAGCAGAAGTACGGCATCGAC
TACTGATGGAAGGTATGGATCTTGACACCGAAGCTTGACGGAGCGGAGGGAGGGGCAGCACTCTGGGCGAGACCGGAGCGGAGACTGGAAACCACTTGAG
GGGTAGAACGAAGATTCGAAAGTGATTGATTGAGGTCTTTAGCTCGCTAGCCTTCTCGCTACTCTAGACCTACTGGATACACACTACTTGATTCTTTACT
GGATACTGAGTTACTTCAGCCAATGAGAGAGCGCCACGTCGAAGCCCATCTTGTACCTACAATCTTGTACCCACAGGTGGCGTAATCGACAGTGGCGTAA
TCGTCGGTGGCGTAATCGGCGTGGGTTCGGATTGGACCGGTTCGGGTTAACCGGTTCACGGTCAACAACCGATACCAAACCGGTAACCCTCAATAGGCTT
CAAGCAGAAGTACGGCATCGACTACTGATGGAAGGTATGGATCTTGACACCGAAGCTTGACGGAGCGGAGGGAGGGGCAGCACTCTGGGCGAGACCGGAG
CGGAGACTGGAAACCACTTGAGGGTAGAACGAAGATTCGAAAGTGATTGATTGAGGTCTTTAGCTCGCTAGCCTTCTCGCTACTCTAGACCTACTGGATA
CACACTACTTGATTCTTTACTGGATACTGAGTTACTTCAGCCAATGAGAGAGCGCCACGTCGAAGCCCATCTTGTACCTACAATCTTGTACCCACAGGTG
GCGTAATCGACAGTGGCGTAATCGTCGGTGGCGTAATCGGCGTGGGTTCGGATTGGACCGGTTCGGGTTAACCGGTTCACGGTCAACAACCGATACCAAA
CCGGTAACCCTCAATAGGCTTCAAGCAGAAGTACGGCATCGACTACTGATGGAAGGTATGGATCTTGACACCGAAGCTTGACGGAGCGGAGGGAGGGGCA
GCACTCTGGGCGAGACCGGAGCGGAGACTGGAAACCACTTGAGGGGTAGAACGAAGATTCGAAAGTGATTGATTGAGGTCTTTAGCTCGCTAGCCTTCTC
GCTACTCTAGACCTACTGGATACACACTACTTGATTCTTTACTGGATACTGAGTTACTTCAGCCAATCAGAGAGCGCCACGTCGAAGCCCATCTTGTACC
TACAATCTTGTACCCACAGGTGGCGTAATCGACAGTGGCGTAATCGTCGGTGGCGTAATCGGCGTGGGTTCGGATTGGACCGGTTCGGGTTAACCGGTTC
ACGGTCAACAACCGATACCAAACCGGTAACCCTCAATAGGCTTCAAGCAGAAGTACGGCATCGACTACTGATGGGAAGGTATGGATCTTGACACCGAAGC
TTGACGGAGCGGAGGGAGGGGCAGCACTCTGGGCGAGACCGGAGCGGAGACTGGAAACCACTTGAGGGGTAGAACGAAGATTCGAAAGTGATTGATTGAG
GTCTTTAGCTCGCTAGCCTTCTCGCTACTCTAGACCTACTGGATACACACTACTTGATTCTTTACTGGATACTGAGTTACTTCAGCCAATGAGAGAGCGC
CACGTCGAAGCCCATCTTGTACCTACAATCTTGTACCCACAGGTGGCGTAATC