Description :
From Genome Similarity Track
Location :
Scaffold_3014:40- 2678
Sequence
2638 bases(100 bases per row)
CGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCCAG
CAATCTCGCCGATTTTGCTGATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGAATTTCACCGTGAGTCCCAAGAAGATGCTC
AAGTGAAGATTGAGCCAGGGGAAGAGGCGTCGTCGGAAGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAG
GAACTCTGTCGACGGAAGAGAGGTGGATCCGGATCCGGATCTAGAAGAAAAACCTCTCTATCCTCTCCAGGTCCCCTCGGGACCCCTGCGGATCTTGACG
CAAGTCAAGATCCGCTAACAAAACAAGGAAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACTGTACCTTAACCCAACCCC
GCTAGTCGAAGAAACGAGAAAGAAGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCA
AGCTGGTCCGACAAGGGTCTCGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGA
TCGAAGATCCAAAAGAACCGGTGAGAGCACCAGCAAAAACGGCGAACAAGCTGGTGGCAGTCAAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGT
AGCTGGCGTGTTCGACGCAGAGGATATCTTCGAGCTAGACCTGGATCGCATAGTATCCGCGACGCGCGACCTCTTTGCCAGAGTTAAGTCCATCACCGGA
GAATGGTCGCGCACTATGGATCCAGTGTCGTCACCGAGGATCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCGGCGGAAGATGGCTCCTACACGTCGT
CCGAGCCCCGATGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGGAGCGCGGGCGAGGATCCGAGGACAAGAAGTCCCTGTGAGCGTGAAGACTCG
GGATCCAGTACACCCCACCCGTGATCTGATACAATCCAGCCAAGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGGTTATCGTCAGATCGGGCTCAAGGT
AATCGCCTCACGGATCCTGTCTCGCCAGTGGCCCAGCCGGCCACAGGCTCTTCCGACACCTCCTCGGGCACCCTGCAACGACACTTCGAAGCTGCGATAT
GTCGGTTTCTGGCCGAACAAGGTATGAGAGGGCCCGTGCCACAAGCGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAATCAGTGGAGGG
AGACAACTCCCATAATGAGTTCGACCCAGATGATCTGGATGGCCCATCCCCTTCGTCAGCGGTGGTAGCAACAGCCGCAGCCGGGGCGGGTGGATCGTCC
ATGATCCAGAGGGTACGGATCTCAGCCATATCGGATCTGATGGAGTTCACGGGCAAGGCTCAAGATGAGGGCCGAGCGCGAACATGGATCAGCAAAGTCA
AGTCGGCTATCATGAGAGATCAAGCGTCGACTGCTGAGAAGTGTCTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAAATGGTATCGGCAGCTGGG
CAGATCCACCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATACTACCATGCTCGC
CGCAGATCGGATGAATCCCCGCTAGAATATCTGCATCGACTAAATGTGGCCGGTCTACGGGCCAATTTGAAGATCAAGGATGGGGGATCCAAGGTACTAC
GGGAACATTTGGATCATTTCATCGAGACGTTGGGGGACGTGGATCTGGCCGACAGGCTGACCCTGTTACGTCTTCCAGACGCATATGAGCTTGAAGAAGT
GCCGCGGGCTGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCTAGTATCGCCAAAAGGCTCCGACGCCTACGGCTCCAGCTCGA
CGTTCACAGCGCCCGACGCAGGAACTGAATCAGGATCCGACAGCTCGGACTCCGACCCAGAGGATTACCGTCGAGTCTGTCTCACTGCATCCAACTATCG
AACGGCGAAGACCGGAGACAACTCTCGACCGAGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGACAGCCCAGGTC
AGGTGTTCGCAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCGCGGAGATCATT
GCTTCTACGTGTGTCGCGGGTATGGCGAGATTCACGACGTCGGCAAGTGTCCGATGAAAGAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAA
GCACAGAGGGATGTTGCCAGAAGTGGCAGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTATTGCATTT
ATGCATTTGTGAACAAGACATCGCTAGCTCCAGGTAGC