Description :
From Genome Similarity Track
Location :
Scaffold_1051:4- 9885
Transcript NameFunction/comments
Phyag_g9273hypothetical protein
Phyag_g9274hypothetical protein

Sequence
9881 bases(100 bases per row)
AAGACCCCACCACAGGAGGTGGCAAGCACGGAAAGGAACAAGGAACACACACCCAAAGACAACCCCTCGATCGGCTTCCCCAAGAACCGATCAACCTAAa
ccgacgactgcgtgaAGCATATCCGCGTAGTTGTCATCCCTACAATCCCAAGTACCGTCCATACGGCCCCAATCAGATCACAAGACACTTCGCGAAGCAC
CAGAAGAGCGTAACCCGCCTAAACCaacgggtacacaaggtgagaAGGAGTTTAACGTCACACGGACAAGCGGAGCACCCCCTCCGTCAGTTGGTAGTCT
GGGCAACCGTTGGTGAGTTGAGATCACGTCACGCGATTTTCGTGaaacctgctccaccacaaTGGTGCGCGTGCCCGGATCTTCTGGTGACTTCGGATAT
CACCGCGAGTCATCCACAGAAGATGTCAAGATCAAGTTGGAACCGGGGATTGAGGCGTCGGCGGTGAGTGGATCGCCGCTGATGTCGTCGAACGAATCAG
GATCCACCGAACGGCAGAGCGCTGGGAGGAGCTCTGCCGGGGTAAAGGAGGAAGGTCCAGCGATGGACCCAGAAGAAAAACCTCGACCTCCTCCCCAGGT
CCCTTCGGGGACCCCCGCGGATCATGCTGCGAAGCGTGATCCGCCGGATGAGAGTCCGTCGACCAACATCGATGGACCCTCACCCACCACCACACACCCA
CCCTCGCGTACAGCTAAGAAGAAATCGAAGCCGAAGGCTTcacggaagaagctgaaggcgcCGGACTCGGATGCTGATGATGGTGGTCTACCTCCGACAG
ACGGCCAACTAACGTGGACCTTCCTCTGCAAGGAGTTAGAGgacttcttggccaacgACCCCGTGATGAAGATTATCCGTCCGAAGTTGATCACGGACCT
CTGCGGACCAGTGTCGTCACCAACCGAGATGACCAACAAGCTGGAAGCAGCCAAACTCGTCATGATGACGCTGAAAGAAGCAGGTCTGGTACCCGGAGCG
TTTGACGCGAATGAGCTGTTCAATCTGGGACTGAAAGAGATCAAGGAAGCAGCCTCAACCCTTGTCGAAAAGCTAGCGCCGCTGGTAGGCGTTGCCGCCC
CGGGAGAGATAgccaagatggagcagatgcGTAACCATGAGTATCAAACGGGATCGTCACAGTACGCATCGGTGACATCAGAAGTCGACTCTGGTAGTTC
GATCGACATGCAGCGCATGACGTTGGGACCTTCGGGAACCGCCATGCTGCAGGATCGGAAACGCGACGCGAGGCCGACGAGGGCCATGAACAGCCCGCCG
CTCTCCGTAAACCTGGTGCCCGGCACACATGGACCAGATCGCATGCAGGATTTCTTCGATGCCGCGATGGAACGTTTCCTTAAAGAACAGCGAGCAGCGG
GATCGGTGCCGACGCCTGACCGATCGAAGACGCCCGGAACACAGGATGTCGAGATGGAGTCCATCGGGTCACACCACGACCCGTCGGACGAGTACGACCC
GGATGACCTGAGCTTGGACACACCACGCCCGGCCGCCATGGCAACCGCTGAAGCGCTGACAGGGAGCGCCTCCATGGTTCCTCGGATCAGGGTATCGGCC
ATATCCGAGCTGAAGGAATTCGCAGGGAAAGACAATGACGAGGATCGCGCGAGAAGCTGGCTGAATAAAGTGAAGTCAGCCTACGTGCGCGATCAAGCTC
CAGACAAAGAGAAGTGCCTGGTTTTTGGCGATCTGCTCACGGGTCCGGCACGCAACTGGTACCAGCAGCTGAGTCGATCGACACGCAGCGATTGGACGCA
ACTGCTCGAGAAATTTCAGACGCAGTATTGTGGAAGAGGAGTATCTTTCGCGAAACAGTACTACCATGCCAGGAAGCGATCGGATGAATCACCTCTCGAA
TATCTTCATCGGCTGATTGTAGCCGGCCTGCGAGCGAAGCTACCGGTCAAGGATGGACCGTTGGCCATGCGGCGCGAACATGTCGAACACTTCatcgaga
cgctggatgaTCGCGATCTGGCCGATCAACTGGCGCTGTTGCGACTAACCGACGCCGAAGACTTGGAGGAAACGCTGCGGGCCCGTCAACGTACGAAAGC
ACGACAGggcagagctgctgctggatcgaACAAGTTCCGACAGAAGACCCCGCCCACCGCTCCAGCTGCCCCCACCAAACCTACACGTGCAGTACGGGCG
ATTCGTACGACGAACGATAGCAGCGGATCGGAGTCGGAGTCCAGTGGTTCGGAGTCCGAGGCAGAGGTTGCTCAAGTCTACCTGGTTGCTGCCACCAACG
GCGTGAACCTTGGTGATGCGCGGGCGAATAGCCCAGATAACCCAGGATCAGCAGCTGGGCCCCCGAACGCGATCTCCCACGCCGGTCAGACTGGTCTGCC
AGCCAAACGGTGTTCCCACTGCGGATCACCTAAGCACGGTGACTTGggctgctggaagaggctGACCTGCCAAAAGTGCGGCCGGAAAGGACACCCGTCC
GATCAATGCCTGTTCGTCTGCCGTGCGTGTGGAGAACTGCACGAAACCGGAAAATGCCCCATGGAAGAGTTTTACAACTTGATCCGCATGTGGTACAACC
CCAGCAAACATGCCGGGATGCTGCCCACAAACGCCGAGAAGATGTTAAACTAGGACGCTCGCCAGGTTGGAAACTGGTACGAGCCGAGCGTTCTGAGCTC
TGCATCTTCGCCTACGTCGGAAAGCACACGGACCTGAAGGTTAATAAGCCGATCGACAATACATTTGAACTGCATGGAGAACATACCTCTGCGATTGCAA
GCCTGCGAGTGGATGAGTATGTTCGATCGAGCGTGGCAATGGAGCTGGACTTGTTGCCGGGTGAATCGCGTGGCTACTGGAAATATCACGCCCCCGACAA
GTGGTTCAAACAAGCCAAAGCGACCGCCAAGATCAACAACGAGAAGGCGACGTTACTCTTCGACTCTGGCGCCGAAGTCTCTATTGTGGACACCTCTTTT
GCTCGTAAAGTAGGCTGTACCATAGACGAAAGTCAGAGACAAGAATGCGTCGGAATTGGAGAAAGCGCATACATGACGACGGGACGTACCAAGATCAAGA
TCACGCTGGCAGGATCTCTGGTGTACTACTTCGACGCTTGGGTTGGCTCGTTGTCAGGCCAGGAAGCAATCCTGGGTATGGACTTTATGGTTCCGGCAGG
AATCCGTCTCGACCTCGCGGACGGATCGCTGTGTCTCCCGGATGAGGTGCGGATTCAGCTATCgggacgacgacaactctACAGTAGTAGCGTTCGGCTG
GTGACCGCCGACCAATACCTGGAAGTCCCGGTAGGCGAGTCGGTAGAAATAGTGACccgctccagcgcctcagATCGACAGACGTTATGGCTTACTCGTG
GAGAGAGATGGGTGCCCACCGTCGTGAAAGTACTTGGACGATCGCAGTACCTGCGGATGACGAACGTGAGCGATCGTGGATTAACGCTGCACCGTGACAC
ACTAGTGGGAATGTGGCTCACCGGAGATCGCGCACCCAGGCGTCCGGGTTTTGTGTCGCCAGGATCGCGTAGGTATGCCGAGTGGCAAAATCTAGCGTAC
CAAGCGACGACCGAGAGATCGGGAGAGCTAGAGTCGGACGAACCGCCTACCGGGCCAAAGGTAGATCGGCCCAGATACGACACTCCGACCAGGATATTGA
CGCACCAACCCGATCGCTCAGGACGAAGGATTACTACGGTGGCACCACATCCCACGACTGGGAAGGGCTCGATAGAGAAATCGTCCGAGCCGAAATGTGC
TATCCAAGAGGAGTCTGGAAACCCCATCGAGGGAGACTCAGCTAAGGAGGAACAGAAACCGATCCCACCCAAAGGCCCGATCGATCTGAGGAATTCCCCG
ACAGGTGCGCCGAGTGTGGGACTTGCGCCGCCCCCGCCGGAGTCCGAAACCCAGGGAGAGGATCAGATCTGCTACCACGAGGGCGGTGATTTAGCTGTTG
AGGACCTGGAGAAACAGGGGGCGATCCTCCTGGAAGTGGTAGCCACCACAGACGAAGTCACGATCGAGGATATCCAAGTTGGCGATCCTTCCCAGGACGC
TCCTGAGGACATAGAGCGGTTGCGCCAGATCATCTGGAGCAAGCGCCACCTCTTGATCGGAAAAGGAAACGCCCTACCCCCGGCGGCCCGCGGTGCGATT
TGCGATATCGATGTGGGAGGCGCGGCCCCAGTGGCGCAGCGTGTACGAAGAGTAGCTCCACAGTTCCGCGAAAAGTTTTCTGATCTGATCAAGGGACTGT
TGTCCGCGAAGATCATCAAACATTCGACCTCTCCGTGGGCATCGCCGGTGGTGATCATCATAAAAAAGAATGGGGTCGACATCCGCCTCTGCATAGACTA
CCGGTTGGTGAACAGTCTGACCAAGCTGATGGTATACCCCATGCCGCTGATTAGCGATCTCCTGGAGGACTTGGACAAGGCACTCTGGTATTGTTCACTA
GATATGGCCAGCGGATTCTGGGTCGTCTCCATGACAGAGCGTGCTCGGCTGATCTCCGCGTTCATCACACCTTTCGGGCTGTTCGAGTGGACGCGGATGC
CGTTCGGCCTGAAAAACGCACCCCAGATCTATCAACGCTTGATCGATAACGCGCTGTATGGGCACCTCCGGATCGGCCCCATTCAGGATCAGACGCGTCC
GATCGACGTGTTCAAGGATGGTGAGCCGGAAACGGATCAGAGGCCGTCGGTATTGGGAAGGCGATCATACATCGATGATATCTTGATCACGGCTCCCACG
TGGGATGCCATGTGTAGAAAGGTAGGAGACCTGCTGGATGCTTGTGATCGATGGAATCTGTCGATCAGCGTTGTCAAGAGTTTCTGGGGACGCCGCAAGG
TGGACTACCTGGGCCACCAGGTGTCAGCCGATGGTCTAGCGGCCAATCCGAAGGATCTGGAGTCTCTGAACAACCTGCCATTCCCTTGTACGCTGCGGTC
GATGCAATCCTTCCTGGGAAGCTTGAACTACTATAGCCGTTTCATCGAGGATTTCGCAATATATGCGGCGATCCTGCATGAATTGCGGGAGTCGGACTTC
CATGAAATTCGCAGTCGAGAAGAGACAGGAGATCGACAAGTAACTGGGacgaagcaccaccagccagTGAGGATGACCGATGGGCGAAAGCCAGGACcgc
cttcgacttgctgaagacgaagattGTGTCGACTCCGATCCTACGACACTTCGATCCAGATCGAGTTCCGGTGATTGTGGTGTATGCTAGTAAGTGGGCA
ATCTCCGCGGCACTTCTGCAGGAGCACGATGGCGTGTACTGGCCAGTAACCTTCACCAGTCGAACCTTGAAAGCGAACGAGATCAACTACGGCATCGTGG
ACAAGGAGGTGCTTGCACTTCTGCGCATCTTGGATGTCTGCTACACAATCTTGGTCGGGAGATCGATCGTCGTCCTCTCAAGACACTCCACGCTAGCGTG
GTTAATAAATTCCGCTGGTCTGGATGGGAGACTGGGCAGATGGGCCGCTCTGTTGTCGGAGTGGTCACTGGAGATCAGGAAGTGTACGAAGGGCGAGGAT
GAAGTACTGGGGACGATGGCCGCGAGCATCACGCCCCGTGCCGAAGTCGACGAAGCGCTGACAGCGATCGCaccgaagaagcagccgcGTCAGACTATCA
CCATGCCCCCACCGACGGTAGAGCCCGACGAGGGCCTCCTCGTCGCTAACTTTGACGGGTCCGCACGAGTGAAgcgaggcggcggcgcctACAGCGCGAT
AGTCTGGAAACTCCCGGAGTGGACGATCGTGGCGGCTGCCTCGGGTTACGCAGCCGATCTGACCGTGAATGAGGCAGAATATAATAGATTGCTTCTCTGC
TTCGATCTCCTAACGAAGAACGCGGACAGGGGACGGGTCGTGATCTGCGGAGACTCCAATCTGGTGATCAGACAGATGCGCGGCGAGATAGAATGCAAGG
CCCCGGGCTTGCGGCTGTTGCGGCAGAAGGCGATGGATCGACTGCGCTCCTGGCCAACCCATGATTTCCTGCACGTGAAGCGAGATTGGAACCAAAGCGC
AGATCGGTTAGCAAGTGCGGCGCTTCAAAGGCAGGAAGGTGCAGTGATTACctcggacgaagagctgcaagatcTGATCACGCTGAATCGACTGAGCGAG
TTGCTCAAGCCGAAGACATCGGAAGCTGTGGTCTACGTGACCGCCGTCACTAGATCGGCGACGCAGAAACGACACCGGCCGGAAGTGTTGCAAGAGGAGG
TCGTCCGACGACTGCGAAGCGAGCGCATACGTCAAGcacaagacgaagaaaagTGGATCATCAATCTGAAGTCGTACCTGAACGGATCTGTAGAGAACTT
GACGGCGGACGAAGCCAAGTCCTGTCGGAAGATCGCCGCCGATtacgaggtggacgaagccGATCTGCTTTTCTTCTGTCCcgactcctcctccttaGAC
GCCGATCGCGATCTGGTTGCCCGACTCGTGATACCGGAgactctgcagcaggacATCCTACATCATTACCACGCTAGCCTCGAAGGAGGACACCAAGGGA
TCGGCCGGACGTACCAGAGAATTAGATCGCACTTCCACTGGCGTGGGATATACCGAAGTGTCCAGCGCTATGTGGGAGAGTGCGCAGACTGTGAGACGGG
AAAAGGGCGACCCTACCTGCAGGGCAGATCCCCAGGGAACATGCGAGCCACGTACCCCTTTCAGATAGTGGCGATGGACCATGTACCGTCGCTGCCGAAG
TCTTTCAAAGGGAACACGGAGCTTCTCATTTGGGTCGACCTGTTTTCCGGCTACGTGATCGCCAAGGCGAGCAATTCTCGGACGGCCCAAACGGTCGCCG
AGAATTACGAAGAGTGCGTCTTTAGACGCTTCGGCGCAAGCGAGGCCCTTCGACATGATCGTGAACCTGGATTCATGGCTGATTTCTTCCGGGCATTCAA
CCGGATAGTGGGACAAAAACAGCGGGCCACGATGGCCTATCGCCCGCAGGCCAACGGAACAGCTGAAAGGATGGTGCAAACGATGACCCGGGCACTCAAG
ATGTATGTCGCAGACGTAAATCAGCAAGATTGGGACGAGTACGCGGAGCGCTTGACCTTCGCGATCAACACGGCGCACGATCGCGTCCGAGGAGACACCC
CGTTTTATCTGATTCACGGCTGGGATCCACGTACGACGTTGGAAGCCGCGCTGCCGCTGGGCAGCACGCGCCGTCGAGACGTCGAAGCCCGGCGATGGAG
GTATCACGTGCAGAAACAGTACCAACACGTGAGGGAACGAGTCAAAGAACGCCTGCGTGAAGCTATTCGAGACCGAGCTGATCGGCACAACGAAGGCGTG
AGACCACACAAGATCGAAGTCGGTATACAAGTTTGGCTATATTTAGACAGGGTGAAGGAAGGCTACGCGAGGAAGTTAGCCCACATGTGGCATGGCCCGT
TTCGAGTAGCTGAGCTCGTGGGAGAATACGCAGCCCGCCTTGAGACCGCGGGTACCGAGTACCGACTCTTCCCCGTGGTGCACctgtccaagttgaagcc
tGTCCGAGTCTTCCCTGACCGCCCGGAAACTGACCTGACGgtgaatgaagaagatcgcttCGATTTTGATGAGGCCTTGCTGCCGGAAGATAGTTGGGAG
GGTGTCCGAGGGGAAGACGAGTACGAAGTGGAGCGAATCGTAGACATGCGTACCGGACGCCGTACTCGCTACGGCCGAACCCATCGCGAATTCAAGGTCT
ACTGGAAGGGATGCGAAGAGCCATCCTGGGTCGATGAGGCGGATCTAAATTGCGGGGCCCTGTTGCGCGAGTACGAGCGcgcgatggtggcgaagaATCG
CTTCAGAATGATGCAGTCCCATGAGGAGGAGACGCAAGATCCGTAGTAGGCTGGCTACTATGGAAAGGGGTGTAGTGTGACGAGTGCACAGGGTGGCTAT
GCACTGAGGAGGAAGGGCTGTGTATGTGGAGTAACGATCGAGCGTGGCCACACCTCGATCATGTGCGGGTGGACTACGCTCGATTAAAAGAAGAAAGGAA
GATGAACAAGAACGACTGGTGAACCAAGAACAAGTTGACCGAAGCGACGGACTCGTGGAGGCAAAGATAACACGAACCAAGCTGACATTGCGATATGCAG
TTGCGAGCAGAAAACCTGTGCTAGCCTACGATCTGGAGGCGCTAGCTCACTCTGGAGTGCGGTCGATTTTTCACGCGTCATTGaccgctgctggaggcac
GAATTTGTTTGTCAGACGATCGATTTGCGAGCCAGGATGATTCTCGATCTGACCGCGGTACCGGATGCGCCACGGCTCGGCTGCGTCCACAGCTCTCAGC
GCGTCAGCTAGGCTGGTCGGGCGGGGGCTCATTCCGAAGCCAGGATACCAGCTACGCATCTCACCTGGCCGCGGGTAGTTCAAGAAGTGCGGATCTAGCA
AGATGTCTAGATCGTACTGGCCGGCGATGATCGACGCAAGCACGCGTTTTAGGAAGGCCTTCCAGCGCGCCCCGAGTCGGGATCGACGCTGCTTCCGACC
CGTCCAGAGCTTGGCCAGGAAGGGGAGCTGTTTGCGGAGAAACGAGCTGATCTGGAATGCGTGGGTGGACTCCCACAGGgcctgctggtgctcgctCACG
AGCTCTTGATAGCGAAGTGCATGGGGGGCAAACCAGCCGTCGAGCCGAAACGATCGGGGAACCACCGATCTATCGAACACAGTCCACGGCTTAGTAGCAT
ACACCGTTTTGACCTCTTGCTCGGTGATCAACTCGGGGCACCACTGACGCGGACGTGGTGCCCTGCCACGCCTCGGGAACAACCAGCCCTTAGGCTGGGA
GAAGTGGTGGAACAGCAGTTCGATGTCCAGCTCTAGAACACTTATGCGTCGGATCCGATCGGGGCTCCAGGGGGCGATGGCGGCAGCTGGATATCGGCCA
CGATCTCGGTATCCTGGGATCCATTGATCTCGAGGAACCACAGTGGGGGCGAGCTGCGCATACCCAGCCGCCGGGAGCAGAGTGTTGCGATGAGAACGCG
GAGCGCTGACGATGCTATCGTCACTGCCTGCACTCCCGTCGTCCTGCCCACTGCCGGCCGCCGAGTCCACCTGGCCGCCATCCGAATCGGCAGCCTCGGT
GGCCACCTGACCGATGTCGCTCTGGTCGTTGACTGACTCAACTCCCGTGGAAATCTCGCTACTGCTGTCGTCGCGATCCGCACGGGAGTTAGGGCTCGGA
CCAgcgtggctgttgctgccttcgctGGACGAGTCGAGGCTGATCGGCCTCGTGGGCGATCCACCGGCGGTAGTAACGGAGGatcgacggtggcgacggg
TGGCAGTACGAGATTGGGCCAGCCCGGCACGAAGGGGATCGTCGCTGTCGGGGGAAACCGGAGGCTGGCGCGCTCGATTAGGCGTAGTCCGGCTACGACG
GCCACCGCGGAGGCGCCTCCCGGGGACGGACGCCGTGGATCGACTGATAGACGAAGTAGAGCGACTCGGCGAAGATGGCCCGAGCGAGTGTCCCGAACTG
GGGGCTGCCGAGGAATCCGATCGCGGCTGTGGAGtccgcaatggcgacgaGATCCGTGGACGGCGGCGCGGAGGGGCCGACGAACTAGCGGGGGCAGCCG
ACTCACTGCGGCGGCGTTTGCTGGTGGAACCACCCGGCGAAGTTTGAACCGACAAAGGTTGATTCGATCGCGCCGGGCGCCCGGACGGAGCTGAATCCGA
CGTGATCGGAGCACCTGCGGAAGATGCCGGCTGGACGAGGTCGACTGAGCCGGCCACACGAGCACGGATGGTGTCTCGTTC