Description :
From Genome Similarity Track
Location :
Scaffold_501:4- 8684
Transcript NameFunction/comments
Hyaar_Emoy2814235reverse transcriptase

Sequence
8680 bases(100 bases per row)
ATCCCGCTGCTGTGATATTTGATCGCGGTATTGCGATATTCACTCTCGGTATCGTGGTATTCGATCTTGATATTGCGATATTCGGTCTTGGTATTGCGCA
GCTTAACAGCCAATCGATCCTTCTCAATGAACTGTCGCGGTTTGAGATCACTCCACCCAACGATCGCCCCCGATTGCTTCGATCTGCTTTACCACAGCCG
TCCTCTGCACTAATAACCTACATACAGTGTTGGTGTTTCTGTGCACTTCGTCAGCGGTAATCTCCATCTTCGTAGATCTGCTTGTACGCGTTGTTCTTCA
TGGACGACACTGGTGATCAGTCGATCACCTGCTCGGGCCTGCCTGAAGCTTCAAGCTCCTCGCCACCGGCCGCAGTCCCTTTACGCTCTCCATCTTCGTT
TCCGAGTGGCCGCGTGAGCTTTCTCCCTGCGATCGATCGGCGTACCTTACGATCGTTTATCGACGATCACTACGACTGCGCTGAGGCCCATCAAGATCAG
CTAACCGATTACAGTACGATCCACGATCAGTTGAGAGCTCAAGAAATTCGTGGCAATCGCTTGGAACGCCAACTGCGCAACGTTCAAGAATTCGCTGGAC
CGATCCGGCAAATTTTTGAACAAGCAGTACAACAATCTGCGTGACTCGTTGGCTGATGCCGAACAGAAAACCGCTAAATTCCAAGAGGAATTGGCTGATC
AAGAGGAACGTCTACAAGAGATTCCAATCCTGAAGTCTTCCCTCCTGAAGCTTAAAGCGGCCCGCCATGCCGAACAAGAGAAGCATTGGCGTCAACTGGC
TATACTCCAAACCGAGTTGGAATCAGCGATTGCTTCTTCCAAGGATGCCGATGATCAGGCGAAACTCCAGATCGAAAAAGCGAAAACCCGATTTGTCGCC
CGCCAGTCCGCGATCATGCGGGAGTTAGCCATGGCCCAGCGAAACTTGGGTACAATCAAGACTAAGCGCGATCGCTTCGCAGCTTAGATTTCAGATCTCA
CGACTCAGCGCGATCGGCTAAACTTGGATCTCGCCGATCGAGATGCCGATCGTGGTCGGTTAGTGAAGAAAGTGGGCGAGTTAAAAGTTGAGCGCGATCA
GGCACTCCAGTCGACAGATTCGCACTTCACTCGCACGGCTGAAGTAGTCTCCAGTGCCTCTCCAAGTGCTCTGCCTGTGCCTGCCGCGCCTCCCCGGAAA
AATTCCCCGCTTCGACAAAAGCGATCTCCCCCTAACTCCAAGTCCGGGAAACCGAAAACCAAGCGTGTCCGTCGTACCAGATCGTCGTCGGGTCGATCTG
CTTCTCCTGATCCGTTTGGTTCTCGATCTTCATCGCCAGAGCGATCGGAGGGCAGCGATCAAGTTGATTCTTCTGCTGCTGATACCGATGATTCTCTGCT
GGCGGCATTCTCGTCTTCCCGTTCTGCCGCCCGACGTGGAACTGCATCGCCTTCCAAGAAATCATCACTTGCTCCGAATTCTCCACCGATCAGCGTTGAT
TCCGCCAGTCCGGAACACCAACCTCACGGTAGTCCCTCGCGAATATCCATTTATTTGGAGAGCCTTCGAGCTACTTTGAAGGTAACCTCAGCCTCTCTGG
TGATTCTAGGAGTCCGTGTAATTCACTGCTGACACCTGAAGAATTTTTGGCACTTCCTGACACCCACATACCCCGCGATCGTTGGATTCCGGGGTGTCGC
GATCGGGTTCCGCGATCGGCAGTAAATGTGTCCCCTTGGTCCACCCGAAGAGTGAGCCTGATCAGCTTATCGGAGCTGGACATAGACTTGTTCTATCATC
ACTTTTCAAAGACCAAGGGAGACATCTTCCCGATCCAACTGGGCAAGGTTCGCCCTCCTCCGGAGTCGTCCTGGTCATCTCAGTTGATCACGTCGGCCAA
GATCGACCAATTTTAAGATCAACAACCTTGGGACCTTTATGATCAATCCATACACCTGATCTCCTCCAAGCTTTCCGGCTGGTTCGAAAAACTAGTCGAG
GCGTATGAAGGTTTCGTGGATAGCCATCGCCAAGCTCTGTGGGAATCGACCCATTTCTTGTGGTTTGAGCAAATGTGAATTTCATTTGCTCATCGTCGAT
ACGACGTACGTTTATGGCTCTGTCTAGTTCGACGAACCATAACAACAGGGAGTCTTCCTCGGTTGGATTACTGTTTAGACAACGAACTCATGCAAATAAA
GAAACCCATCGTTCTTCGCATCGACAGTAAAGCTAAAATTCAACAAATTGCGCGTAAAACGAATCCTGGATTGGCCTCTTTGCGCGAGCGAGAAGGCAGA
GACGATCTCGTGCTGGCCCCCGTTGGAAGCGGATACTGCAGCTGATTCTTCAAGATATGATCGACGGCCTTTGCGATTTGGACATTTTACTGGACCCCAT
GTTTCTACACTTTCTCCGTCCGAATGAAGCTAGGGTGTGGTATCCCGGCCTATCCGTGCGGTGGACCAACATACCCAACTTGATCACTGCTTTGTCGATC
AATCACGCTTCCGAGCGTTGGAGGAACCAGTTTCGTCGTTCGATCGCATCCGACCCTGGATCGTCTCTTCCAAGCTTGGGTGGTAAGTTCTTTGACCGCG
AGTGATTTACTTGGTCTGTTCCATGATGCGATCTCTCAATCTACTTTCTTCTCATTTCCATTTGGTCGCTCCCATCATTCGTATTTCTTTCATCTTTTTT
TGTCTTTTCATCTTGATCGCAGCATTAAGTCTGCGATCGTCGCACTCAATTCACATAAATCCCATTCCATCTCCATGTGCAACTTCCTTGCACCCATAAC
TCTTCTCCCCGTCCATGCACCGTCCTTGCATAGACCCGTCCACTCAAACTCTCCGATCATCGCTATTCTCTGGCTCTTCCTCGTGCGATTGCATCACATC
AAAACGATTCTTGCTCACCTGATCGCAATCGAACTCTTACAGCATAGCTCGAAAATTTAGATCAGCTTCGTCAATTGGGTCACTGTACTCCTTCCATTGT
ACCAGGTACTGCTTGTGTATTCGGCCATATCTCGTCTTCCGTCCTGATCGCACATCGATGATCTTGTCTACTTCAACTCTTCCGCGTCGAGATTACCCTC
CCAACTATCTTCCGGCAGCAGTGCTTTATCAAAATCAAACCGAATTGCCTCATCCGCATTTAATCCACCCGTTGGGCGTTCTGGGAATATGCGAACTAGC
TTCAGCTTAGACACGTGGAATATTGGGAATAGCCGGTACGGCGTGCCGGCGATGTCCAACTTTACGGCGTGATCGCCACACTTCTCGGCCACTCGAAAAG
GCCCATGCCACATATGGGCTAGCTTTCGAGCATATCCTTCCTTGACTCGGTCTAGATATAGCCAAACTCGCGACCCGCGATCGGTATCCAATAAATATCG
ATCTTCATTATGTCGATCGGCTCGACCTCTGATCGCAACCTTCAGTCGTTCATTCACTACCGCCCGAGCACGTTGATATTGGCGTTGCATACCATATCTC
CATTTTCGGGCATCTCGATCCCGGGGTTTGGTACTTCCCAACGGTAAGGTTGCTTCCAAAGTCGATCTTGGGTCCTAATCGTGAATCAGGTAGAACGGTG
TATGTCCTCGAATTCTATCATGAGCGGTTTTGATCGCATAAGTCAATCGCGCTGCGTATTCGTCCCAGTCCTTTTGATTTTCATCCATGACATACATCTT
GATCGATCGAGTCAGCGTCTGTACCATGCGTTCAGCCGTACCATTAGCTTGCGGTCTATACGCCATAGTGGCCCGTTATTTTTGTCCCGCGATCCGATTG
AATGCTCGGAAGAAATCAGACATAAATCCCGGCTCGCGATCATGTCGTATCGCCTCACTCGCAACGAATCGTCTGAACACGCACTCCTCGTAATTCTCTG
CGATCGACTGGGCAGATCTGGACGAGCTTGCCTTTGCGATCACATATCCTGAGAAAAAATCTACCCACAGCAACAGTTCGGTGTTTCCTTTAAAGGATCT
TGGCAACGAAGGGATGTTATCCATAGCTATAATCTGAAAAGGGTACGTCGATTGCATATTACCAGGTGATCCACTTCGATCCCCCGGCCGTCCTTTTCCC
GTTTCACAATCTACACATTCTCCCACATGCTGCTGCACACTTCGGTACAACCCACGCCAATGGAAATTCGCCCTGATCCGTTGATAGGTACGGCATATTC
CTTGGTGACCACCCTCCAAACTTGTGTGGTAGTGGTGCAAGAAGTCTCGCTGTAACTGTTCTGGAACCACCAAACGAGCCAGTTCAGTACGATCTTCAGC
TTCGGTGGCCGATCTCGGACAGAAGAATAGCAGCCCACTTTGGTCTAATTTATAGTCCGGTGCGATCAGGGTGCACACCTTATCCTCAGCTGCCGAAAAT
TTAGCTACGTCTCCAACCAGATATATCTTCAAACTAGATATCCAGTTTTCTTCGTCTTGTGCTTGCTTAATACGACCAATCCGTATCTGCTGCACAACCT
CTTCCTTTAAACCCTGGGCTGACAACGTCTTCTCTGGGCTGTTCGAGTGATAGCCGCTAGTTTGATCGCACGATCAACTCGTTCTGGTAGTAGTAATTCG
TTTAACCGATTGAGAGTAATCAGGTCCTGACGCTCTTGATAGGAAACCACAACTGTCCCTTTTTCTTGCCGCAGAGCTTCACTCTCCAATCGATCTGCAC
TCTGATTCTAGTCCCGCTTCATGTGCAAGAACTCGTGGGATGGCCACGATCGTAATCTCTCCATAGCCCTATGCCTCAGCAACTGCAGTCCCGGCGATTT
ACAGTCGATTTCTCCTCGCATTTGACGGATCACCAAATTCGAATCTCCGCAGATAATCACCCGTCCCCTTGCCTGATCGGCAAGCAAATCGAAACTAAGG
AGCAGCCCTCGGTATTCTGATTCATTCATGGTTAGATCAGGGGTATACTCGGAAGCAACAGCCACAATCGTCCATTTCGGCACTTTTCCATGTACTCGCG
CTGTATGCTCCGTCCTTTCTTTTCACCCTGGCTGATCCATCGAAACTGGCTACCAGCATGTTTTCATTCACACCTACTGTGGGTGGTGACATGCTTATCG
TCTGTCTTGGCTGCTTCCTCGGGGCGATCGCAATCAATACTTCATCTACTTCTTCACGAGGTGTTATACTTGCCGCAAGCATGCCGAGTATTTCATCTTC
TCCCTTCTCAAATCGCCTAATTTCCAACGTCCAGTTCGATAGTAAAGCAGCTCATCTTCCCAATCTTTCGTTGTGGCTTGAAGATTGTAGTAACCATGCT
AGTGTCTAATATCGCGTAAGCACCGTAATCTCACGGGATACTAGCATAGTATAGCAGATGTCTAGCATCCGGAGGAGAGCCAACACTTCTTTCTCCACCG
CCCCGTAGTTGACTTCGTTGGGCCTTAGCATACGACTAGAGAAAGTGACAGGCCAATACACACTATCATATTCTTGAAGCAGAGCAGCTGATACAGCCCA
CTTACTAGCATACACCACGATTACAGGCGATCGATCGGGATCGAAATGCTTTAAGATTGGAGTTGTGGCTATCTTAGTCTTTAGCAACGTGAATGCAATC
ATTGCCTTCTCCCATCGATTCCTGCCCTCCGGATCGCGATCGTCCCCTGCAATTGGGTATAGATCGACATTGATCTCCGGTTTTGGGTACAGATCACGAT
CGCCCCCTGCACTCCTTTCGTGAATAGCATCCGGTCTTACAGCAGAGGTCGGTTTTGGAGCTTCACTCACGCGGTTGATCTCATGGAAATCTGCTTCACG
CAGTTTGTACAACACTGATGCGTAAACTGCGAAGTCTTCAATGAATCTACTGTAATAGTTGAGACTTCCCAAAAATGACTGCATCGCTGGCAGCGTCCGA
GGGAACGGGATGTTCACCAACGATCCCAGATCGTTCCGGTTAGCTTCCAAACTAGCGAGCGATATTTGATGTCCCAGATATTCAACCCTGCAACGTCCTC
AAAAACGTTTGGCCAAACTGATCGACAAATTCCACTTATCGCACACCTCCAATAATCTCTCCGCTTTCTCATACAGGGCCTTCCACAACGTAGCTGGTAT
TAAAATGTCATCAATACAAGATCTTCGACCCAACACTGATGGTTTTGGATCAGTATCTGGTTCACCATCAGTGAAGACATTGATCAACTTCGGCGATTCC
GCCGTGGTCGATTCGGATTTTACGCCGATTTTCAAATACCCATACAGAGCGTTATCGATCAAACGTTGGTAGATCTGTGGAGCATTTTTCAACCCGAAAG
GCATCCGCAACCACTCTAACAACCCTGATGGTGTGATAAAGGCGGAAATCGCCCTTGCTCTTTCCGTCAACTCCACCACCCAAAAACCACTCGCCATGTC
CAGAGAGCAGTACCACATAGCTTTATCCATGTCTTGCAATAGTTCGCTGATCAGTGACATCGGATACACCATCAACCTAGTCAGCTGGTCACCCGCCCGT
ATTCAATACACAGCCTTATGTCTTCTCCGTTTTTCTTGATGATCACCACTATGGGGGACACCCATGGTGATGTAGACGGTCGAATGATCTTGTCCGACAG
TAATCCCTTGATCAGATCGGCGAGTTTTTCTCGGAACTTTGGTGCTACAGGTCGGACCCGTTGTGCGATCGGGTTAGCTCCTCCCACGTCGACGTCACAA
ACTGCCCCACGCGCCGCAGGAGGTAGGGCGTTACCCTTTCCAATAAGTAGATGCCGGCTCTTCCAAATCGTTTGGCGCAACTTCTCTTGATCCTCGGTTC
TTGGGGTGCCGGGATCGCCTACTTGAATATCATCAATCATTATTTCTTGTGTGGGCGTACCCACTTCGGGAAGAACTACCATGTGCTGATCCACATCTTC
CGCGAACAACTCGCCACCATCATGTAATACATCGGTGTTGACGCTAACTCATCTCTCGTCGTTTCTTCGTCGATCTTGGTATTGCCCACTTTTTTCGTCC
GTCGATCGGCCTGGTCTTGTAACTCACAATCTTTGCTCTTAATCCCGTAAGGCTGATGGCTGGACTTTTTATGGACTGGATCAGTTCTTCATACCCGTTA
TCCTCAATTTCGCTCGATTCGTATCCCGTCTGTTTCGGTTGATCTCTAACTCGATCACTCTGATCCCTGGTTCCGATCGCATCGATCACCATTGGAGGTC
TCACGGTCTTCTCCTCTTCCGCAGGTGTGTCGATCTTCACCACTTCGTAGTCCTCGACCAGTCGATCGGCCTGTTCCTGAAACTCACCATCTTCAATTGC
GATCGCGGTCTGACTGATGGCTGGACCGTTTGTGAAACGGATCAGCTGCCCCATGTCGGATCTCTTCCGTCGCAATCACCTTCACGCCTTCGATCGCTTC
ACTGGGCTGATCTCGTCCTCGATTGGCTTCTACGGTCCCTTTGATTGTGTAGATCACAGAAGGTATTTCTGTTGATCGTTGATCCTTTCTCGTCAAGTGA
CTTCCGTCCATGGTTTGGTCTTGACTCTCGCTCCCGTTGGTCGTTTCTTGGTCTGGTTGCGACATGCGCTTCCCCGATATTTCTGTCGTTTGGCGGGGTA
GAATTCGAGTGGGCCTTTCATACACAGGATGATCCACCAACTGCCCTGCATACTCTTCCACTGTCTCTTCCTCACGTTCCGTAGTCACTTCAAACGCTAG
CGTTTTCCATTCTGTATCGCCGTGACCCGATCGATACATACCCTGGTGATCTAGGTATCATGTCCGATGTCATCCACAAAGCCAACGAAGCTCCATGATT
TAAAATTATTTCACGATCGCTGAGGTTCGTGAGCTGCAAATACTTGATCTGATCGGGCCCATTAGTCACTGTCGGCACCCACGCCACGTCTCGCTTCAAC
CCAAAGCTTAGCTTTAGGTGGGCCAACCCCAATACGTACTTCTGTCGATCTGCCAACCGTTATGTCCACATGTTGATTATTCAGGTTGATCGCCTGCATG
GTCGATCGATTAGGTGGCTTCCGTCCTGCCAAACTAATACGCACCTCTTCAGGTAGACATAATGTTCTGTCGGCTAATTACAAACGGATGCCCGCCGGAA
CCATAGAATTTATACCCAATATGAATTCTTAGCCGACCTGACCACCAACCCAAACGTCGAAATAATAAACCAACGATCCATCCAAAGTGATCTTGATCTT
CGTCCGTCCCACCGTCATATACGTGTTCTCTCCAATTCCGACGCACTCTTGTGTTTGACTGTCGTCGATCACACATCCTACCTTACGAGCAAAGGTAGTA
TCGAGGATCGACATTTCAGCGCCGGAATCGAACAGCATCGTGGCTTTCTCATTGTTGATCTTGCCAACCGCTTTTGCTTGCTTGAACCATTTCCGGGGGT
GTGGTATTTCCAATACCCGCGCAATTTCCCTGTCGCGAGGTCGTGCTCCATCCTCACAGGCGATCGGGCGTAATCATCCACTCTTTTCTCACTTGATATC
GACGAGACCAGTGTAAAATCTATATGTAGATTAGCGATTGGATCGAACCGGTCGTTAACCTCTTGATCTCTTCGTGGTCCTTCCACAAATGCATAAATGA
AAAGCCTAGAACGCTCGGCTCGTGCCAGATTCCAACCTGGCGAGCGTTCTAGTTTAACATCTCCTCCACCCTGGGCGGAA