Description :
From Genome Similarity Track
Location :
Scaffold_1257:4- 4584
Sequence
4580 bases(100 bases per row)
CTGGTCGATCGAAAGAATGCCATGGTCTCGTCCATTTGGTTTCACCCCAACAGCCGGTAGGTCCAGCAGGATAAGtgttgtgattgcacttcgtcgtcta
ctCGACGGGGTCGCTACCGCTGGGCACACGGCATGCGCGTGACGGGCGTGTGCCATGTGGgggctgcagttgaagtgacatgAATGTGCGATCTGATTGG
GCGATCATTTGGGATCGCAGGCTGTGATTGGACggctggcttcaacttgcacgaCATGTGGTGATTTGCATGGTATAATCACGAGCATTGACGAGACCAG
CGTTTCCATACAAACTGCAAGTCTAAGACGACCCTTTCCGTCCCAAAAGAGCCTTTCCGTCTCATTTCTCAGATTAAGTACGAAGATGTAGGAGATGTAG
TGCGACTAGGAGAAAGCTAGGACGTCTAACTCAATGgagctcactttcggatttcaTTCCTTTGAACACTTCACTACAAGCCTCGCCCGCATACTCGCAA
TTAGACCAAACAgcagaccagcagcgccgccgcctccaagaccagcagcaggagagctGGTAGCTGGAGTTGCGCCACCTAACAAAGCACGAAGCTCCTC
AGGCATGCCCTCCATGACTCTCCAGAGACCAAACCAGTGACTTTGCAACCAGTGCTTCTAAAGCAAAAACAACAATCGGATTTGGCAGGGATTAATTTGC
CGAAGTTGCCCAATCCGTCCTGACCAAAAAGCTCAGGACAGCTGGGGTAATAATACTGGTATGTGATTGGCCGAGAAAGTTGCCCTAGTTAACCTGCCCC
GAATGAAACATCCCCTCAGCGGATGTTTCATTCGGGGGCAGGTTAGAGCGAGGAGCTGAGTGGACTGCTCAGTGATGACGGTATTGGTAATGCCCGAGTT
TGTCTCCCGAACCTGCTGTAAGATTTGCTCACAGTATTATGGCGCTCACGTGTAATCAGTTCAGGATACAACACCACACAATATTGGTCTATCGAACATT
TCTGTCATCGCCACTTCTTTCGTCTTTTGTGGGTACTGGAGATATTAATATGACTAAAAGAGGATTCATTGAGGACTCATAGACGCTGTGGTATCATTCA
TGACAACGAAAACCTCATTTACTTGTACCGTGATTCGACTGTTGCCTTCTGACTTATGGAAATCagagaaagagagagagagagaggatcagactgtcta
ttGAGTACTTATGACTATTCTTAAGATGTCTGTATGGAAGTTTGTCTGGTCTTCCGCAATGACTGAatcgttctcctcctcgctaCATCATTCTGCTGGC
TCGATACGTGCAACTCAGAGAAGGGCACGTTGACCAAGTCCGGGGTAGATTGGTGCGCGCAGGGAACATTGGACGCCTGGCCGGGAGGCCAGTTACCACT
TCGGCAGTCCCAACGAGCCATCATATCCCCTGGGCACGTCTACGACTGGATTCTCAAAACTCATGGATTGCCGATTGCCAATTTTATGTGGCATCATGTG
ATTACCGGTATCACATCACAGTGATAGGAACTGTATCTTCAAAGCGTCCCTGAATGAGCAGGCCTCCTTTACCTTTAATCTTAGgcacgcgttgctgcgc
cCAACTCGCTGCGTCACATTTTTAGTTTAACCTTACTGTTTGTATTGAGTATCTCACATCGCCCTATAACCTAACCCTCCCGAGGATCGATGTCATCGCG
GCCTTGGGCTTTGCTTCGCAAAggcagtcgctgcgctcctgcGAGGAAAAGATTCTAAGCTCGGCGCTGagcccgcctccgcaaacACCgcgcggccctg
cttcgcgggcacCCCGCGCAGGTTTGCAGTGGTTACGAGCGCTCGCAACCGCTCTCCTCCGTTGGTCGTTTTATGTGACTTTCACCCCTCCTTTTCCAGT
TGGGTGCACCACTCACTCTCTTAATCTTATCGATACCCCAtaccctgaacaaaccaaaccacgaaacgctcaagaaattggtttggtcgtaaactacgcg
ggcttgtgaaccaaaattacgtaaaaTATTGGCAGATACACTCAGCATCCAAACCACGGCGAGAGGTTTGGAGCATTTCGGGGACagaggtttggagtta
cTTGATAATTGAAACGACTGCCGGCTTTCCTGGCACGATACAACTTGTATTACGAGTCGTCCCGGGTTCAAACCATGAAATGAattcaaacctggtttga
aCGGTAATTTTGatttggtttgaacggggcctggtttggtttggtttgttttGTTCAGGGCGTGCGATACCCTTGCAGCACCAGGGATGCCTCATGGGAA
AAATCATCTGCAAACAAATTACATTCACCTCGTCCGTAATTTATATTAGATGATAATTTATGTGGAAGTAAAAAACGGCAGGCGTTGATGCGAGGCCCGT
TTAAATCCTCTCAGGGCTATTCGGAAAGTTAAGTAATCTTATCCGGTGAAATCTTGGTGCCATGGTTCCAAGAAAAATAGTGCACCTACTTACGTCCCCT
CCGTTGCATTGCCAACGCAGACTGCTTTGCATTTATGTACTGTTATCACTTTGGCCATCCTTTGAGACGTCATCGGCTGTCTTAAACATCTACAAAAGGT
GAATCACGTCCTACAGCTTATTGGGGGATTCAGCACAAACTTACCGTCATTAGCTTGATGCCGTCGAAATTATGATGTGCTTACGCTGGCAGCTGACAGC
CGTGCGCGCATACTGTGACGGTGAGGCCTCGAAGCCTTCGACGAATGGGCGGCCTTCTGGCAGCATGCTTTACGGTCCGTGCGATCGAGGAATGAGGCGC
CGATGGATGGTCAAGCCCGTGCCATAACGAATTGACTGGTGGTACAGCAGACTGTCTCGTTAAAGAAGTCAATATACGGCTTGACTTCTTTATCGAGACA
GTTTACTGTAATTTATACTGGGATAGCAGTTGCCTGTaaggttgctgctgtccagcCAAATCAGGTTAATTCGCGCCAGTTACTGAAGCCGGTAGCTGAA
GCCGATATTACTGAAGCCCGGATGCAGTAACTGAAGTCGCAGACGGACAGTGCGGCCAGCAATTACTGATACTCTTTGATAGGATCCgctatcccagcct
tcgcgtagccctagtttCTGGAGAAAGTTTTCTCGATCCCGTAACAAATACCACCGTCATTATCTTACTCCTACACAGCCCTGATAGATGCTCAATACAT
AGCCCAGGTGAGGCGGGATCTTGGCACAcagcgcagctcgtggagcagatgcTTGCAAGTCACCTTTAGGACAGCTCGGAGGCATGGCTGAATGAACCAC
GACGACCAAAGCGTTCTCGAAGCCATTCGACTTCTGCGGAGGCGACGCATGTGCTGGAAATGCCTGCCGCTTCGCTACAGAGCGGGTTGATTCTGCCGGC
GGTCCGAGTAGCTTCGCGTGGTTCTTGCAGCAACCACGTATCTGGACGTACTTGTGGCAGCCCGGTGCGCGGCAGTAGCGACCACCGCCGTGCGAAAGAC
AGAGACCCTTCCACTGGGCGAGTTTAGAGCAACCGTCGAACACGCAGCGACGTCCTCCGCCGTGGGCAACACACAGGCCTCGACTCTGCACTaacttgct
gcagttcgGACTACGGCAGCGCACGCCACCTCCGTGCGCCTTGCATAACTTGCGGGTCTGCGCTTGCTTGGTGCATTCAGGAACGATGCATCGTGGGACC
TTTTGACGGATCGTAGTTGTTGGCATGACTGAGTGCGAGACTGGAGATCGAGTGGTTTGCGCCTTGGATAGTAAGTGTCAGAGTGACCGGTTACGCTCAC
GCTGTAAGACGGAGAGTTCGTACCACACACCGATAACACCAATGGTGTTACACCATGGAGCACAGCTCAGCATACAATGTATGATTGTGTGGAACTGCAC
CGGCTGTCCTATCCGGGATCCGCTCTTTCCTCAAAGGTGCCTGGTGAGGCGTGCCTGTGTAGATTTCTTCTCCCTTACCCGGCACAAAAGCAACCTCTTA
TGATAGTtgagtacatgtagacaCCGTCAAGGGAAGCAGTAGAGCACGCACTTCTATCATATCTGTCCGAATCTTAGCTGCTGGACAGGTTATCATCTAC
GTTATGGGGCGACAGGATCGCCAGTGGTATTATAATAGCTGACGTGTGGTTTTTCGTCAACCTACGTATCTTGGTGGTGAGTTTAGCGGCGCTAGCTGCT
ATAATACCGGCAGGGTTCTGCGTTGCCGCCAGCTGAAGGTCATACGTCGCCGAGTTGTGCTGGGTGAAACTAAGGAGGGCCATTTCCGAGGATTTGTCCG
GAGGGCCATTACACTATGTTAGTACAATCGGGGCAGCCGTTTTCTTACATAACGAAACCTAAGTCAGTGCCCATCCCATCGAGGGTGTCTGTCTGCAGAG
GATGTAAGTTGAGCGCTATCTTATAATATAAGTAGTAAAACCGCCTTTGAGACCtaccgctggagatgctcttagGCCGCCTATCGACCTCACCAAACAC
AACAGTCTCACTTTCGAAAacgacacagcagcagcacttcacCAGCAACACTCACACAGTTTCCCTCTTGAAAGGTTCCA