Description :
From Genome Similarity Track
Location :
Scaffold_1280:4- 4178
Transcript NameFunction/comments
g16407.t1ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum
g16408.t1ETP25916.1 hypothetical protein F441_01272 [Phytophthora parasitica CJ01A1

Sequence
4174 bases(100 bases per row)
GCCATTCTTTGTTATATGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAA
ACTTTGCGAGTGCATACTTCATGGCAAGGAGTCCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACG
ATCACGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCGCACACAACGTGGAATGGGCGATATTGGTCGGCCACCGCC
AAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCTTCGAAGGCTTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACA
GCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACATTTGAAGGTGTAGGCCA
TTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTC
TTCAGGTTCGCGTAGAGCTTGTGCTTTAGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATTTACCATTCACAGCCCGGC
TGTGAATGAACACGTCGTCGAAATAGCTCGGTGCGAAGTCGCGTACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAG
CCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCTGTGAGAGGGATATCGCTCTCACGCATGAGGATCTGATAGAACCCG
TCTCTCAGATCCAGAGTACTTAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGCGCCTGTACCGTCGCATCGT
TCAGCTTGTTATACGCATGAACGATGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCC
TGCATTGCGACGACTTTCAAAGCAGTCGTCGATTGCCTTGACTTGCTCACGCTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAGTACTTCGTTCC
CGGCACGAGATCAATCTCGTGCTGAACACCCTTATCCTGCGGCAACTCCGCAGGAATGTCGTCCGGGAGTACATCCCTGTACTCACGCAAGACCTTGTAA
AAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGCCCGCGCCCTCAGAGATGAGCTGATTCA
GCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGTTGGCGAGCGAAACGCTTCCAGCTTGT
GACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTATTCAGCCTCATCTTCTTGTATTGAAGACCAATACTCGTACGCGTCAAGACATTCAAT
GTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTGTAGCGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTTCTCGCTTGCGCC
GATCACTTCTCGTGCGGAGCCCGGCTCCGCAAGTTTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTATCCGCGG
GCGCACGCGTTCAAGCCCAGCTTGATCGCGCACCGCTTCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCATGCATTTCCGGTGCGGGACGTTTGCAACCG
TCCGCACTGCTTGCAGCGTCGGCTCCCAAAGCCGACGCGTCTTCTTTACACCTACGCCTAACGGCGGAGTGTCTTTCGACCAATTGTGTGTCGACATTAC
CTGTCGACACGACCGCGTCGCCCCGGACGCTTCGAGACCCTCTCGAATCGGATTGAACCAGGCCTTGCTGATTCGGTTCACATCTTCTCCCAACGACTCT
CGCAGTCGTTGGCGTTCGCTTGGGGTGACCGGAGACAGCCGCATTCCGCGCTGTCTCTAGTGGAGGGCCGCATGCACCACGCGGTGCATGTGCTGCGCCG
ACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCATTCGATCACCGAATCATGCCGTGCAAGCCACGGCA
TGCCCAACACCATATCGAACTTATCGTCCTGGAACTGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTACGATACGCTT
CTCGGTTCTAACAACGACACCCGTTGCTAGCCTCAATTCCAATAGACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGA
ACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTTGGCTTGTCATCTTGCT
TCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCC
CTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGACGATACACAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCGTAG
TGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCTCGACGCTGCTGGGAACCAGCAGCTGTCGCACTCGAGAGGTCCATTGGTTCGGGAC
CTCCCGACGGCCTTGCCACCGGTCGTGGCATTAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAAT
TGCAGCTTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGGCTCGTCA
ATCGGGTTGGTCACGATGTTCGAGACCAAGTACTGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCG
ATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTACTTGAACTCTTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTA
CGCCCAACTCCTCGCTTGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCG
ACAAGCCAACGGAGGAGAGGTTCCCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTTAATGACTCCACGCGCGGTGTGGCCGATGGTGACACCGAAG
TTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGC
TTCCCCAATGACTGTTGACAGTAGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGG
CTACCCACGGACATGTTAGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAGTGCTACCAGGTGTAA
TGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAATTTACTTAAGTTCTGTATACTTGTATCCACAA
GTATACTTAAACCTAGATAAAAGAACCAAACGGAAGCTTTGGTGGTAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCT
AATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTG
TTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATGCCTTAGTGCATGTTGCACTAAGGTAGGAGGTG