Description :
From Genome Similarity Track
Location :
Scaffold_1093:4- 4004
Sequence
4000 bases(100 bases per row)
GATCGAGCGTGAAGATGGCTTTGGATATTGCGTTGGGGGAGTCGCGTGGTTACTGGAAATACCATGTGCCTGACAAGAAGTTCAAGCAAGCGAAAGCTGT
AGGAAAGATCAACAACGAAAAAGCTACTCTGTTGTTTGACAGTGGTGCCGAAGTGTCTATCCTAGACACCGCCTTTTCTCGTAAGGTGGGGTGCTACATT
GACGAAAGTCAGACATTGGAGTGCGAAGGCGTCGGAAAATCTCCATACATGGCGGAAGGACGTGCACGGGTCAAGATCACGCTCGCTGGATCACTTGTGT
ATTTTTTCGATGATTGGGTGGGTCCGCCGACCGGCGGTCAGGACTTAATCATCGGCATGGACTTCATGGTACCGGCGGGTATCCGCCTCGATCTTGCCGA
CGGGACAATCTGCCTGCCTGACGAAGTGCGGATCCAGCTCGCTGGGAGACGTCCGCTCTACGGAGACAAGGTGGAGCAGGTGACCTTGACCGGTTACCGC
GAGATCGACATAGCGGGAACCGTTGAGGTGAAGCGGCGCACAAGATCAACAGAGCATCAGAAACTCTGGGTTACGCGCGGCGATCGGTGGGTGCCTACCG
TGACTGGTGGATCGGGCAAGATCCGCTACCTGCAACTGACAAACGTGAGCGATCGCGAGTTAGTGCTGCATCAGGGTACGCGACTCGCGATGTGGCTGGC
CGGAGATCGAGTGCCGCGCTTACCTGGGTATGTCTCCGTTGGATCTCGCAGGTACGCGGAGTGGCGGAACTTCGCGTACCAAGCAACCACCGATGCTACC
AAGGACGTGCCTGAGCCCGCCGACGTGCAGGGGTCTGCTGTGGAGCGGCCGCAGTACACAACGCCGACGGCGATCTTGACCCGGCCAGCGAAAAGTGTAG
AGGTGGCCACTGTGCACACCGAGTGCGTGGCGTCCAAGCGCCCCGACGATTCCAACCCGGAAGAGTCGTACGGCAACCCCACCGCGTCTTACTCGACGCC
CGGCAGGGACGAGCAGCCCAAGAACAGCGATGAATTCGGCACGGGAGAAACGCGCCATGATTTCGCCACTTCGCAGGGGGCGGAGAGACCATCGGGTGAT
TACGACGCTGGAAATACAGCGTGCGACACGGATTGTTTGGAAGATCAAGGCTGCGATCGGCCCCAGTCGGTGCGACATGGTGCATCTAATCAAGATCGAG
TGGTTGCGACGGGTGGAAATCAGGTGTTTCATCAAGATCGAGTGGTTGCGACTGGCGCAAATCAGGCGTCTCATCATGATTACGGTGGTGCGACAGGCGT
AAATCAGGCGTCTAATCGAGATCGACGGGTCGAAACGAACGAAAATCCAGCGAGCCCCAGCGTCAGTCACGAGACGCGTAAACACGCGTCGGGAAGTGAT
CTTGAAGCTGATCCACGTCCAAATGCAGTTGACCCGGAAGATCCTGAAGTCTGCATCACGGAAGGCGGTGATCTCTACGCGGAAGATATCGAAGGTCAAA
TGGCAGTGCTCCCGGAGTTCACCGCGACTGACGAAGTCGTGATCACGGATATCCAAGTTGGTGATCCTGGCGAAAACACGCCGGAGGAAATCGACCGGCT
GCGGAAGATCATCTGGCGCCGGAAGCACTTGCTTATTGGAAAGGGAAATGCCTTACCACCGGCCGCAAAAGGTGCGATCTGCGACATTGACGTCGGAAAC
GCGAAGCCAGTCGCTCAGCGTTGCCGTAAAGTGGCGCCACAGTACCGCGAGAAGCTGGAGCAGCTAATCAAGGGGCTCCTGTCGGCCAAGATGATCATGA
TTTCAACGTCCCCTTGGGCATCACCGATCGTGGTGATCGTCAAGAAGAACGGGGTCGACATCAGACTCTGTATTGACTACCGTCTGGTCAACAGTCTGAC
ACGTTTAATGGTCTACCCGATGCCGCTGATCAACGATCTCCTCGAGGATCTCGACAAGGTGCTCTGGTATTGCTCGCTGGACATGGCTAGCGGTTTCTGG
GTGGTAACGATGACAGATCGAGCTCGTGCGATCTCCGCGTTCATCACTCCATGGGGACTCTACGAGTGGAACTGAATGCCATTTGGACTGAAGAACGCGC
CACAGATCTATCAGCGGCTGATCGACAACGCACTCTACGGCTTCCTCAAGATCACGGACAACCAAGATCGACAGGGACAGATCGATCTGGTCAAGGACGG
AGAACCAAACGTAGAGCATAAGACATCTGTCCTGGGCCGTCGATCTTATATCGATGACATCTTGGTCACGGCCGGTTCGTGGGATCCGCTGTGTGAGAAG
GTGGAGAAGCCGCTAGATGTCTGCGAGGAATGGAACTTGCCGATCAGCGTGGCCAAGAGCTTTTGGGGATTGAAGAAGGTCGACTACTTGGGACATCGAG
TATCTGCGGAAGGACTGGAAGTTCACCCGAAGGATCTATCAGCATTGGCCAATCTGCCGTTTCCGACCACCCTGAGATCGATGCAGTCATTCTTAGGCAG
TCTCAACTACTACAGCAGGTTCATCGAGGACTTCGCGATCTACGCTTCAGTGCTGTACGAACTTCGTGAGGCCGACTTCTATGAGATCACTCGGAAAGCC
AAGATCGAGGTCGGCGCAGATGAAGTCGAAGCTGGTGAACGCCAAGCTGACAGTGACAAGTGGGGTCGAGCCATCACGGCATTTACGGTGTTGAAGGACA
AGATCGTGAAGGCGCCGATCGTGAAGGCGCCGATCCTGCAGCACTTTGACCCAGATCGGGAACCAGTGGTCGTAGTGTACGCCAGCAAGTGGGCGATCTC
TGCGGCGTTGATGCAGGAGCACGATGGGGTGGACAGGCCAATCACCTTTACCAGCCGCACGCTCAAGCCGAACGAGATCAACTATGGAATGGTGGATAAG
GAGGTTTTGGCACTGCTCCGGATGTTGGATGTCTGCTACACGCAACTGGTTACCAGATCGATCAAGGTCCTGACCCGATACTCAACATTGGCGTGGCTGG
TGCATTCTTCCGGTTTGCAGGGACGCCTTGGCCGGTGGGCGGCGCTACTGTCGTCGTGGACATTGGAAATCGTGAAATGCACGAAAGGAGACGATGAGAT
TTTGGGAGTAATAGCCGCAAGTATCACGCCCCGATAAGATGTCGATTCAATCCTAACGTCGATCTCTCCTCGGAAACGACCGCGACAAGCTGTCACGATG
CCACCTCCTACGGTGGAGATTGATGAAGAACTGTTGGTGGTTAGCTTTGATGGATCGGCTCGTGTAAAGCGAAGTGGGGGGCTTACAGCGCGATTGTGTG
GGGCTTGCCCGACTGGAAGGTAATCTCCGCCGCATCTGAGTACAAGATCGATCTAACGGTGAATGAGGCGGAGTACCATGGATTGCTCCTCTGTTTCGAT
CTTCTAGCAAACCTGGGCAGGGGGCGGCGCCTAATTATCTGTGGCGACGCCAACTTGGTGATCCGTCAGATGCGTGGAGAGATCGAGTGCAAGGCTCCGA
GGTTGGTACTACTACGTCAGAAGGCCATGGAACGATTGCGATCTTGGCCCAACCACGCATTTCTTCACATGAAGCGTGACTGGAACCAGAGTGCAGATCG
ACTTGCAAGCGCAGCACTGCAACGGGAAGGTGGATCAGTCGTTTCAGCAGACGGAGAACGCGAAGATCTGGGGACGCTCAACCGACTCGACGAATTATTG
GTTCCTCGATCTGACGCGGCGGTGATCAAGATCGCGGCGGTTACGAGATCGAGGAGACGAGCAGCCCCACAAGTGTTGGATGAGTTGATGGTACAACGAA
TGCGGACGGAGCGCATCTGCCAGGCGCAGGATGAAGAGAAGTGGATTGCCGATCTCAAGAAGTATCTACGTGGGGACGTGCAGGACCTTACCTCGGCGGA
AACTAAAGCGTGTGCCAAGATTGTCGATGACTACGAGGTCGACGAAGCTGGATTGCTGTTCTACTGCCCGCCATCGAAGCGCTCTGATGAAGGTCGTGAT