Description :
From Genome Similarity Track
Location :
Scaffold_845:4- 3946
Sequence
3942 bases(100 bases per row)
TCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGACCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCTAACC
ATCGCCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTATCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGCCCCTGGATTACGGTAGG
TACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTTAACCGGTCTGGCAGCTCCCAGGTTTCCCCGGGTCCAGGTTGTCTTATC
CGCCCTTATGATCCTCATCTTTGCTCCATACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCTAGATCC
AACCTCACTCCGGCCGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCCGCGAGATCTCCAACCCAGATGTCAAACCAATACACCAAACAACCTG
CCAGCGTGATCTTGATCCGCGTTCTCCCGTTTGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATCCGACTCCCATCCACTTGGCACCCAGC
CTTACGAGCAAAGGCGGTATCTAGTTTAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGAGCTTGCCCCCTACCTTGGCTTGT
CTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTCAGCAAATCAATGGATCCAACATCTTCAGATCCACAGGATTCAGTGA
CCTGACGACCCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGGCCATGTTGGCGCTTCTCCCAATAACCACGTGCCTCTCCCCT
TTGTAGATCCAGGGTTGAAGAAACTTCGGATCTGGCAAACTCATTCACTTGGCGCAAACTAGAGATCTTGGCAACTGACACTTCATGTAGATCACGTGTA
TTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCA
AACCCGGCGAGCGTCCTGGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAAT
TCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCAC
AGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACTTGTGCTGTCTCGTCCATGAGATCTCGGGATCCGTA
CATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTCCTGTCTTCTCCGTTCGATCGTTGGACGCAGTGAGACAGACTCGACGGTAATCT
TCAGAATCGGAGTCCGAGCCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCT
TTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCGCCGCCCGCAGCACTTCCTCAATCTCGTCTGCGTCGGGAAG
TCGTGACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCAACGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATC
TTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAACGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCATCG
ACACTCTCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGGTGAATCTGCCCAGCTGCCGATACCAATTCCTGGCTG
GCCCCGCTAGCAGATCCGCAACGGTCAGACACGTCTCGGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCG
GTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCGGATCCGATATGGCTGAGATCCGTGCCCTCCGGATCATGGACGATCCACCTGCCCTGTTGCTACCA
CTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGACTCCATCTCCACGTCTCGTGCTCCATG
TTCGTGGAGCACTTGCGCTTGTGGCACGGGCGTTCTCATACCCTATTCGACCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGTTGCAGGGTGCCTGAG
GAGGTGTCGGAAGCGCCTGTAGCCGGCTGGTCCACTGGCGAGACAGGATCCGTGAGGCGATTACCTCGAGTCCGATCTGACGACAACCCCACTGGCTTCT
TGCCGGATCTGGCTCGATCGTGGCTGGATTGTGTCAGATCACGGGTAGGGCGTACTGGATCCCGAGCCTTCACGTTCACCGGGACTTCCTGTCCTCGGAT
CCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCGCAGCGGCGGATTCGTAG
TTCGAGGACGCAGCTTGGCCGATCCTCGGCGACGACACCGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCG
TCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCCACGATGCCTGATTCCGTAAGCAAACGTAATAGATCTTT
GACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTTCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGA
TGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAG
CTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCGATTCTTCGACTAGCGGGGTTGGGTTTAGGTACAGTGTTGGCTTAACCGGTGA
ATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGA
GGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCAT
TCAGCAGCGTCTTCGTTGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTC
ACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACT
AACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCCTCACCTTGTGTACCCGTCGGTAGGGCGGGGATCTGCTCTCTCGGTAACTTCCGAA
GAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGGAAATCTTCACTCTGCGTCCGTGGATGGTTCCCGTAT
CCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTGGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTGCTGTCCTTT
AAGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTG