Description :
From Genome Similarity Track
Location :
Scaffold_430:4- 3815
Sequence
3811 bases(100 bases per row)
GTTCGCTTGGCGACAGGAATTCTAGTCACCACACCCAAAGTTCCTGTGAACTTAGGTGTGAAGTTTTTCGATTTTGATAGTGTCGAACGCTGTTTAGTCC
TTGATTTGGACTCGAGATATGATATCATTCTTAATATGGCTTGGCTTGAGCGCCATGAGCCATGGATCGACTGGAGGCCGAAAACATTAGGCGCCACGCG
CACTGCCCCTAGCGGAGCTTTGGAGAGTCATGATCCCACCTCTGCTAGGAATCAGAAGGGTTATTGGCGCGAGCCACTGGCTGACAATGTCAGTGTGCTG
GACATCGGAATGTCAGAGTTAGTTGATTCTGACGATGTCAAAGACATGAGTATAAAGCAAAGCTCGATATGTGATAGTGAAGTGGCACGTACTACGATAA
GTCATAGTCGTTGAGAGATCAATGTACTGAATGCTGAAAGCATTGTTGACCAAGCATCAAGTCATCGAGGGTTGAACCCATCAGATGAGCGTGGAGTGGC
ACGTAAGTACCCACTGAGTGACGTTGGATGTGATAGAGACGCGCTGAATGTCAATATTGACGTTGTTGGTAAAATACCAATGCATCCCGGGCCCGGCTCA
GCGGATGCACGTGAAGTGGCACGTAATTCACGTGATGAAGACGTCATGTTACTCGTCATCGGATGTCAATAGTGACGTCGGCTTGGTTTAGAGCAAATTA
CGTTCGATGATGGTATCGATCAGAGAGATACGAATTCCAAATCGTGTGCTGTGTCACAAAGTGATGATGACTGTCAGCTGTATACACTCGTCAACGGAGT
GACTAGTGCCTGGGCAGCCTCGAGGCTATACCCTCGTTAAGTTTGCTTTTAGAACTCGAAGAGTTGTCGGTCGATGAGTTTGATCACTCACTAAAGAATG
GAGACCTTTCAGAGGTGGTGGTCATTCGACCCAGCATCACAGATTTATAATTTTCTTTACTTTTGGATGAAGCCGTTCTGGAGGACACAAAAGCAGCACT
CAGTGCGCGTAATGGGTCATCAATATTGAAAGACCCTCATTATCCCTTTTATTCCTTAGTCAAGGAATTTCAAGATGTGGTGTGCCACGATCCACCCTCT
TTTTACCTCCAGATAGAAGTGTTCGTCATGAAATTGACTTAGTTCCTGGAACTAAACACTGTGTCACACGACAGTGGACCTTGCCTAAGGAGCAATGTGA
TGTCATTGATGACTTCTTCCGTGCTAAGCACGAAGCAGGAATGGTACGTGAGAGTAAATCTCCACATTCGACACCGACATCTTGTGTCAAAAAACCGAAC
GGCAAGTGGTGTATTGTGCATGCTTAAAACAAGCTTAATGCGAGCGAGTGATATTCTGCTTACAGACACCCATTCCTCGAAAGGATGTTCTTCAAAACAA
CATGGTTGGTTGTACTATGTACAGCGCACTCGACTTGGTCGACGTATATTATCAATTACTTATGCGAGCGAGTGATATTCTGCTTACAGCAGAGAGCACT
CCGAGTGGTATGCTATGGGAATGGCTGGTAATGCCCCAAGGGCTGTCTAATGCTCCTGCAACATTTATTCGTCTGGTGACGCAACTTTTTCCGCCCACAT
AGGGATTACGCACAGACATACTTTGATGAAATTTTTGTCCATAGTCGTGCCGAGAAAAGTCGGGTAGATGTTGCATATCACATCATTTATTTGAGAGCCG
TGCTCGAGTGCATGCGCACTAATAAATTGTACACCAACGCGTCTAAATGCATTTTTGGTGTAGATGAAATTCCTTTCCTCGGCTGTTTGATTGCTAAGCG
CGGCCTTCGAGCGGATCCCGCTAAGGTCAAAGCTATAATGGACTGGCCGATTTCTAATAATCAAAAGGACTTGCGTAAGTGTCTTGGCCTTGCCAATTAC
TTACAAAAATACAGTGAAAATTGCGCTGATATGGCTCGGCCATTAACTGATCACCTTAAGAAGGACACAGATTGGCGCTGGGACAACACTCATGCCGACA
CATTTCGGGCAATAAATGAGAGTCTCCTCCATGCTCCCATTTTGGCGTTGCCAAATCCTGATTACCATTTTAGTGTTGTCTGCGATGCATCCAACTTTGC
CATAGGCAGCGCCATGTTACAAACAGATGCTGCAGGCCGCGAGCGAGTTATCGCATTTGAATCACGTCAGCTGAAAGCTGCGAAAAAGACCTATCCAGTT
CATGACAAAGAGCTACTTGCTATGAAGTATGCGCTCGTCAAATTTAGAGTCCATATGCTTGGCTCGAAGCCATTCGTAGTCTATACGGATCATGCGTCAT
TACGCACGGCGACACAGTCGCCTTATCTCTATCAGAGAATTGCTCGGTGGCTTTCCTTCTTTGCGGAATTTAACTTCGAGGTGAAGTATAAACCAGGCAA
ACAAAATGTGTTGGCAGATACCTCTCTCTCAGACCTGAATATGAGCTTGCCCATGGCACTACTTTGTCGTCTCCTATTGAGGAGTTAATTCGTGTGGCAT
ATCCACTGGATTCTCAGTGTGTAGCATTGTTTCATGCCCTTGGGAGTGAGGAACACAAGGACTCGGATAGTCAATTTTTGGCACGTTTGCAGGCCAGCCT
ACATCGATATTCCATAGATAAGGGTCTCTTGTGCTATCGCACAGATGTAGCGGATACCGCTCGCATTGTTGTACCTCACGATGAGGATTTAAAGTATCGA
ATACTCTTTGAGGCCCACGATACTGCCCTCAGTGGGCATTTGGGCCAGGAAAAGACTTATGCTTGTGTGAGTCAACACTACTGGTGGCCCAAACTCAACA
AATGGGTTAGCACATACATTCGTACATGCGAAACGTACCAGCGGGTCAAACCATCAGCACATTCGGCTGCACCACTCGCAAGTTTCCCTGTGCCCACGGG
GTGTTGGGAGTCTATCAGTATGGATTTTGTGTTTGGTTTTCCCGAAGACTGTGAAGGCAATGCGGGAATTGTGGCCTTTGTTGATCGTTTTTAACCAAGA
TGGCTCACTTGGTGGCGGTGCCGGATTTTATCAATGGCAAAGGTACAGCTATGCTGTTTATCGATCGTATGTTTCGTCAACACGGGGTGCCGCTGGCAAT
CATCTCTGATCGCGACCCTCGCTTCACAGACAAGTTTTGTACTTCCATCTTCAAGATGCTTGGCACGCGATTGGACATGTCCACTGCGGATCATCCGCAG
ACTGAAGGTTAGACTGAGCGAGTTAATCGCGTCATTGGCGACGTTCTTCACAGTGTTTGTACTGAGTCTCCTAAGACTTGGAGCTCGATGCTCCCTGTCA
TTGGTTTAGCGCTGAACAACGCTGTTCATGTCTCTACCGGCTTTACTCCCTTCTATGTGAATAGCCTCACGCACCCCCGTGTTCCGCTCACGTTACCACT
ACGTGGTTCTGGGATTGGTGGGGGAGAATATGCTGGCAAGCTTGCTTAAATCAGCCCTACCACGATGCAGAAATAAGTGAGCGAGTTTCTCGCAACGCGC
TTTAGGGTCGTACGATATGTGCGTGATGCAATGGCTGATAGCCAAGACAAACAAAAAGAACAAGCTGATGCTAAAGGCATAGACTATATATTGATTCTTA
TGAAGTTAGAGACAAAGTCTAACTAAACGCCAAAAACCTACCTATAAATGTAGTGTCTGCCGTCTTCAAGACGAAATTGCGTCCGCGCTTCATTGGGCGG
GCGTTTACGGTCATAGCGAAGTAAGGTCTTGCCTATACACTCAATCTCCCGCGCAAGTTGCGCACCCCCCCAGTGTTTTACGTTAGCTTGCTTATGCCAT
ATCATGATCCT