Description :
From Genome Similarity Track
Location :
Scaffold_68:4- 3764
Sequence
3760 bases(100 bases per row)
GTTCTTAAGCCTTAATTACTTTATCTGGCCAGGCCCATTAGTCACTGTTGGCACTCACGCCACGTCTCGCCTCACCCAAAGTTTGGCCTTAGATGGACCA
GCCCCGATCCGTACTCCCGTTCATTTTCCCACCGGAATGACCACATGTTGATCATTCAGGTTGATCGCCTGCATGGTTGATCGATAAGGTAGCTTCCGTC
CTGCCAAGCCAATACGCACCTCGTCTGGCAGACATAATATTCCGTCGGCTAGATTCAGAAGAATACCCGCCGGAACCATAAAATCCATACTTAAGATGGC
CTCTTGGTAGACTTGATCACCGACCCAAACGTCGAAATAATACACCAACGATCCGTCCCATGTGATCTTGATCTTCGTCCGACCCACCATCATATATGCA
TTTTCTCCAATTCCGACGCACTCTTGTGTTTGACTTTCGTCGATCACACATCCTACCTTACGAGCAAAGGTAGTATCGAGGATCGACACTTCTGCTCCAG
AGTCAAACAGCATAGTGTCTTTCTCGTTGTTGATCTTGCCCGTCGCTTTTGCTTGCTTGAACCATTGTCCGGGAGTATGATACTTCCAATACCCGCGTGA
TTCCCCTGGTGCGAGGTCGAGCTCCATCCTCACAGGCGATCGAGCGTAATCGTTCATTCTTTTCACACTTGATATTGACGAGACCAATGTAGAATCATTA
TGTATTTAGCGATCGGATCGATCTGATCGTTAATCTCTTGATCCTTCCGTTGTCCTTCAACAAATGCATAAATGCAGAGCCAAGAACGCTCGGCTCGTGC
CAGATTCCAACCTAGCGAGCGTCCTAGTTTAGCATCTCCTTCACCTCGGGTGGAAACGTTCCAGCATGCTTCGTGGGCACGTACCACTTTCGGATCAAAT
TGAAAAATTCTTCTATGGGGAATTTGGCACTCTCGTGTATCTGTCCACATGCTGCACACGCGAAGAAAAATTCTTCAGAAAGATATCCTTTGCGACCACA
CTTCTGGCACATCAATCCATTCCAGCACCCTCGATCGTCATGTTTGGTAGATCCACAATGGGTACACGCCTTCAATCGTCCACCACGATTGTGTCCATCT
CTGTCACCATTGTTCTTCTGCCAGGTGCGGTGATCCTTGTCCAATTTTTATTGGTCTATTGTAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTCCAATTTTTATTGGTCTATTGTAATCGTCACGCAAGCTCG
ACGACGATCAATATCTTCATCGGATCCAGTTGAGTCCAATTCCGATCCGCTGCTTTCGACTTTCTCGCGGATCGCTCGCGCTGTTTTCGACGACATCGGA
TTCGAAGAGGTGGTCGTTCGCTGATGAAATTTGTCCGATCCCATCGGCGCTTTCATCTGGCGATTCTCCATCCGTTGGCACGCACGTAGAGTTTTCTCCA
CCTCTTCAACATCCATCAATCGCAGTAAAGTCAGCTGTTTTGCCAGATCACGACCGTCCAGCGTAGCAATGAAGTACTCCGCATTTTCGCGACGTGTGGC
CGAGGTGGCCAATCTATCTTCTTTGATCGCGATCTTGGCGTGCTTTTCTGCAACATTAAGGCGATGCAAGTTCTCCAGCGGGGTTTCATCTGATCTCTTC
CGTGCGATATAAATATTGCCTAGCCACAGACACCCCTTGCCCTCCATACTGAATCATGAAACAATCCAGCAATCGCTTCCACTTGTGCCGAGTAGATCGA
CTCAGTTGGTTGTTCCAGTTTCGTGCTGGCCCTATCAACAGATCGACGAACCACAAACACTTTTCTTCGTCCGGAGCCTGATCGCGCAAGAATGTTGACT
TGACCTTGCTGATCCAGGTTCTGGCCTTATCTTCATCTCTGTCTTTTCCAATGAATTCTTTCAGCTCCGTCATTGCTGACACACGAATACGTTGAGGAAT
TCCACCACCATTCAGCAACTTTTCTGCGGTGGCCACCATCTCACGTCTCCGCTGCTCTTCTTGACCCGAATCATCGGGATCGACGTCTTCCGAGTCGAAA
ATATCCGATCGACTGCAATGCTATCGGACCGATTCCATCTCGACATCTGGGGTGTATACTTCTTGAACTCTTGTAGCCTTAATTCTTTGGCTAGGATAGA
TTGCTTGATACGCTTTCTTCCTTTGTTCTTGTTGAAAACGTTCCATAGTCTCTTCGAGGTACGCCTGCAGGTGTCCTTGCATAGTCAGATTCGTTGTTCC
TTTAGCACGTGCGGTAGTCGATCGTGGTTCAGTCTTGATCGTTTCAACCCGATCGCACAGATGCGCTGCCCCACTTGAGCCTAGACACATCTGCTGAATA
CCGATCGAATCATCCGACTCGATTTTCGATTCAGCTGACGCGTACTGCGACGATCCGGTGTGGTATTCTCTCGGGGTGTCTCCGATCGCTGCTTCCGCTT
GATCCGTAGGATCACACTTACCCGTTAGGGGAGTTAACTTGTCGTATAGCGATCGATACGCGTAGATCACCTGATCTTAATCACACTCCAATATTTCGTT
CGCGTCGAACACCCCTGCGACAAAACCGGCATCATATAGCAGCCGTATGATCCCGTTGATCTCCTCCAGAATAACAGACGCTACTGCCGGTAGGGGTATC
GGACCTTGGATTCCTCCGATCAGCTTGGGCTTCAGAATCCAGAGCACTGGGTCACTTGATAGAGATTATTGAGTTTCTTCCAGTGGTATCCCTCTGCCAA
CTGATCCAGCTGCCATCCTTCCATCTTCATATTGTCGTCCACGAACTTGATCGGTCGGTTGACCGATTTCAAACTGCGATCTGATCCGATCTTGTCGCTT
CTTTCTACACTTGTACTGTCTTCACGTTCTTCGTCTTTGACTTTGCTTGAGTGATCTTTAGTGACAACTGTTCGGTTTTATCCGAAGGGTTTTCGCCCAA
CAGGTCGTGCTTTGCGACACGATCCTCGGTGGCCCCCGAAGGGACCTCAGGAGGGGGTCGAAGTTTCTCTTCCAGATCGCCCTATCGATGTTCCTCTTTG
ATTTTCTTGTCATCAGAGTCCCTACCAAAACTTCGATAATCTGGCGATCCTTTGAAATCACGAGTCGGCGGCGATCTCTCTGCCTCTGACGCTTCCAACC
CAGGTTCTGTCTTTATTTTGACCTCTTCACTCCCGGACTCACGCTGAAATACCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTCGTGGAGTGGCG
ATCGCTCATTTTATGAGGCGATCCCAACTCTTCACTGGTGCGCAAACGACTGAATATCAGAGAGGGTGCTCCGTTTCCGTACCTTGTATTTCCTTCCTCA
CCTTGTGTACCCGACGGTAGGGCGGGCTGCACTCTTCTCGGTGGACTCGTGCCAAGGGAA