Description :
From Genome Similarity Track
Location :
Scaffold_1439:4- 3751
Sequence
3747 bases(100 bases per row)
ACTCACGTTGCACGCGCTGACTGTCCCCACCTGTCGGATCCAGAGTGGGAGGCTCTCCAACGACTGTCAACAGTCATTGGTGAGGCGGCTGTAGCTACGA
TGCTGCGTACGCTAACGCCGACAGAGCAACACGGTGTTGCTCTGGGCTTCATCCTGAAGGAGCAACGCGATGTTGCTGCTACTACCGCGGTGCCGTCCGG
GACGACATCACGCGCGCAATCGCTGAAGCTCAATGTGAGTAACTATGTCGGAAGAGAGGGTGAACCCCTCCTCCGTTGGCTTGTCGAACTCGACACTGCC
ATTGCGGCTCGACGTATCGACGTATCGTCGACCCGTTGTCGAAGGTCGCGTTCGCCATTTCATGTCTTGGCGGACGTGCAAGAAGTTGGGCGTATGGACG
CCGACTCTCGGATCCTACGTGCTTTAGCACGTACGAGGGTTTCACGGAAGAGCTCAGACAAGCATTTGAGCCCCCGCAAAACGAGTTCCGGTCGAGGGCG
GAGTTCCTCGACCTGCAGCAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGAGCACGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGG
CGACCAAGGTCGTCACGTTCATGAAGGGACTGAGAGATTGGCCTGTGAAGACCAATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATCACCCT
TGCAATGCAGGAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCCTGCACATGTGCCGAGGCCACAGCCACGCCCGGTAGTGAGGACGGGAGGCCCCGAACCC
ATGGACCTCTCGGTGCTCGGGAGTGCACGGCCCCCGTGCACCAGCAGGGTGGCTATCGCGCCGGTGCCGGGCACCGTCGCAACCAAACAAAAAACGCTGG
ACGCCAGTAGGCGCGGGGCGCCCTACTGGTAATGCAGTTCCGCGTGTCGACCTTGGACACGCGACACTGAGGACTGCAATCCCCAGTGAGATTCATTCTC
GGTGCAAGAACCAAGATGACAAGCAAGACCTTGTCATCCTGAACGTAAACTCGATGAGAGCAAGCAGCTCTCTTCGCGCTTTGGTAGATTCTGGCGCGTC
GAAGAACTTTGTTCGACTGCGAAGTCTATCGAGGCTTGACTTCGAGGATCTAAAGATACCTCGAAGTATGTTGGAGGTACGACTGGCAACGGGTGCCGTC
GTGAAGACCCAGAAGCGCATGGTACGCGTGCGCTTCACGTATGAAGACCAAGAGTTTGTCGAGACCTTTATCGTCCTGGATCTGGACGATAAGTTTGACA
TCGTATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNAGCGAGAATGAAGAACTGAGCAGTTTCTTCATGGAGACCACCACTGAGAGCGAGGACACTCTCAGTGCGAAGACGAAGAAGGAGCGCTTTGAAGAGCA
GAGCTGGGACTCGTTGAAGACGAGTCCCTACTACGAGATTCTTACGGGAGTACGCGGACGTACTTCCGGAAGAGATTCCTGCGGAGCTTCCGCAGGACAA
GGGAATCCAGCACGAGATTGATCTCGTGCCGGGCACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCGCGAGAGCAGGTCGAGGCGATCGACGACTTC
TTTGAGAGTCGTCGCAAAGCTGGACAAGTACGGAATCGAAATCCCCGCACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACTGGGCGGCTGGCGCATCGT
TCATCCGTACAACAAGCTGAACGATGCGACGATACCGGCGCAAGAGCGCCCCTGCGACCTTCAACAGGTTCGTGACGCACTTGTTGCGCTCGGTGCGCGA
CTTCGTACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGGGATAAGCGATGTTGAGATGTGCAAGGTGCATCCCCGGAAGCTGCTT
GCGCTCATGCGCAAGCAGAAGCTCTACGCGAACCTGAAGAAGTGCATCTTCGAGGCGAGCGAGATACCCGTGCTCGGGTGTCTCGTTGGGAAGAACGGTG
TCCGCCCTGACCCTGAGGAGGTCAGAGTGATCAATGAGTGGCCAACGCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTG
CAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGGTTTGGACTGCTGAGTGTCAGCAGGCCTTC
GATGCAGTCAAGCGGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGTGACGCATCCAACTTCGCAATCG
GATGTGCGTTGATGCAGCACGATCACGAGGGTCGTGATCGTGTGGTCTACTACCAATCGCGTCAGCTGAAACCAGCTGAGCGCAACTACCCGGCGCATGA
CAAGGAACTCCTCGCAGCGGGTTAAGCATGCCCATGAACGCTTCGAG