Description :
From Genome Similarity Track
Location :
Scaffold_501:4- 3336
Transcript NameFunction/comments
Hyaar_Emoy2814235reverse transcriptase

Sequence
3332 bases(100 bases per row)
ATCCCGCTGCTGTGATATTTGATCGCGGTATTGCGATATTCACTCTCGGTATCGTGGTATTCGATCTTGATATTGCGATATTCGGTCTTGGTATTGCGCA
GCTTAACAGCCAATCGATCCTTCTCAATGAACTGTCGCGGTTTGAGATCACTCCACCCAACGATCGCCCCCGATTGCTTCGATCTGCTTTACCACAGCCG
TCCTCTGCACTAATAACCTACATACAGTGTTGGTGTTTCTGTGCACTTCGTCAGCGGTAATCTCCATCTTCGTAGATCTGCTTGTACGCGTTGTTCTTCA
TGGACGACACTGGTGATCAGTCGATCACCTGCTCGGGCCTGCCTGAAGCTTCAAGCTCCTCGCCACCGGCCGCAGTCCCTTTACGCTCTCCATCTTCGTT
TCCGAGTGGCCGCGTGAGCTTTCTCCCTGCGATCGATCGGCGTACCTTACGATCGTTTATCGACGATCACTACGACTGCGCTGAGGCCCATCAAGATCAG
CTAACCGATTACAGTACGATCCACGATCAGTTGAGAGCTCAAGAAATTCGTGGCAATCGCTTGGAACGCCAACTGCGCAACGTTCAAGAATTCGCTGGAC
CGATCCGGCAAATTTTTGAACAAGCAGTACAACAATCTGCGTGACTCGTTGGCTGATGCCGAACAGAAAACCGCTAAATTCCAAGAGGAATTGGCTGATC
AAGAGGAACGTCTACAAGAGATTCCAATCCTGAAGTCTTCCCTCCTGAAGCTTAAAGCGGCCCGCCATGCCGAACAAGAGAAGCATTGGCGTCAACTGGC
TATACTCCAAACCGAGTTGGAATCAGCGATTGCTTCTTCCAAGGATGCCGATGATCAGGCGAAACTCCAGATCGAAAAAGCGAAAACCCGATTTGTCGCC
CGCCAGTCCGCGATCATGCGGGAGTTAGCCATGGCCCAGCGAAACTTGGGTACAATCAAGACTAAGCGCGATCGCTTCGCAGCTTAGATTTCAGATCTCA
CGACTCAGCGCGATCGGCTAAACTTGGATCTCGCCGATCGAGATGCCGATCGTGGTCGGTTAGTGAAGAAAGTGGGCGAGTTAAAAGTTGAGCGCGATCA
GGCACTCCAGTCGACAGATTCGCACTTCACTCGCACGGCTGAAGTAGTCTCCAGTGCCTCTCCAAGTGCTCTGCCTGTGCCTGCCGCGCCTCCCCGGAAA
AATTCCCCGCTTCGACAAAAGCGATCTCCCCCTAACTCCAAGTCCGGGAAACCGAAAACCAAGCGTGTCCGTCGTACCAGATCGTCGTCGGGTCGATCTG
CTTCTCCTGATCCGTTTGGTTCTCGATCTTCATCGCCAGAGCGATCGGAGGGCAGCGATCAAGTTGATTCTTCTGCTGCTGATACCGATGATTCTCTGCT
GGCGGCATTCTCGTCTTCCCGTTCTGCCGCCCGACGTGGAACTGCATCGCCTTCCAAGAAATCATCACTTGCTCCGAATTCTCCACCGATCAGCGTTGAT
TCCGCCAGTCCGGAACACCAACCTCACGGTAGTCCCTCGCGAATATCCATTTATTTGGAGAGCCTTCGAGCTACTTTGAAGGTAACCTCAGCCTCTCTGG
TGATTCTAGGAGTCCGTGTAATTCACTGCTGACACCTGAAGAATTTTTGGCACTTCCTGACACCCACATACCCCGCGATCGTTGGATTCCGGGGTGTCGC
GATCGGGTTCCGCGATCGGCAGTAAATGTGTCCCCTTGGTCCACCCGAAGAGTGAGCCTGATCAGCTTATCGGAGCTGGACATAGACTTGTTCTATCATC
ACTTTTCAAAGACCAAGGGAGACATCTTCCCGATCCAACTGGGCAAGGTTCGCCCTCCTCCGGAGTCGTCCTGGTCATCTCAGTTGATCACGTCGGCCAA
GATCGACCAATTTTAAGATCAACAACCTTGGGACCTTTATGATCAATCCATACACCTGATCTCCTCCAAGCTTTCCGGCTGGTTCGAAAAACTAGTCGAG
GCGTATGAAGGTTTCGTGGATAGCCATCGCCAAGCTCTGTGGGAATCGACCCATTTCTTGTGGTTTGAGCAAATGTGAATTTCATTTGCTCATCGTCGAT
ACGACGTACGTTTATGGCTCTGTCTAGTTCGACGAACCATAACAACAGGGAGTCTTCCTCGGTTGGATTACTGTTTAGACAACGAACTCATGCAAATAAA
GAAACCCATCGTTCTTCGCATCGACAGTAAAGCTAAAATTCAACAAATTGCGCGTAAAACGAATCCTGGATTGGCCTCTTTGCGCGAGCGAGAAGGCAGA
GACGATCTCGTGCTGGCCCCCGTTGGAAGCGGATACTGCAGCTGATTCTTCAAGATATGATCGACGGCCTTTGCGATTTGGACATTTTACTGGACCCCAT
GTTTCTACACTTTCTCCGTCCGAATGAAGCTAGGGTGTGGTATCCCGGCCTATCCGTGCGGTGGACCAACATACCCAACTTGATCACTGCTTTGTCGATC
AATCACGCTTCCGAGCGTTGGAGGAACCAGTTTCGTCGTTCGATCGCATCCGACCCTGGATCGTCTCTTCCAAGCTTGGGTGGTAAGTTCTTTGACCGCG
AGTGATTTACTTGGTCTGTTCCATGATGCGATCTCTCAATCTACTTTCTTCTCATTTCCATTTGGTCGCTCCCATCATTCGTATTTCTTTCATCTTTTTT
TGTCTTTTCATCTTGATCGCAGCATTAAGTCTGCGATCGTCGCACTCAATTCACATAAATCCCATTCCATCTCCATGTGCAACTTCCTTGCACCCATAAC
TCTTCTCCCCGTCCATGCACCGTCCTTGCATAGACCCGTCCACTCAAACTCTCCGATCATCGCTATTCTCTGGCTCTTCCTCGTGCGATTGCATCACATC
AAAACGATTCTTGCTCACCTGATCGCAATCGAACTCTTACAGCATAGCTCGAAAATTTAGATCAGCTTCGTCAATTGGGTCACTGTACTCCTTCCATTGT
ACCAGGTACTGCTTGTGTATTCGGCCATATCTCGTCTTCCGTCCTGATCGCACATCGATGATCTTGTCTACTTCAACTCTTCCGCGTCGAGATTACCCTC
CCAACTATCTTCCGGCAGCAGTGCTTTATCAAAATCAAACCGAATTGCCTCATCCGCATTTAATCCACCCGTTGGGCGTTCTGGGAATATGCGAACTAGC
TTCAGCTTAGACACGTGGAATATTGGGAATAGCCGGTACGGCGTGCCGGCGATGTCCAACTTTACGGCGTGATCGCCACACTTCTCGGCCACTCGAAAAG
GCCCATGCCACATATGGGCTAGCTTTCGAGCA