Description :
From Genome Similarity Track
Location :
Scaffold_1113:4- 3175
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1113-fgenesh-gene-0.0Chromodomain protein

Sequence
3171 bases(100 bases per row)
CCCCCCAGCGAAGGTGAAGCCATTGGAGATCAGACTCAAGCTAGATGCGACGCCGTGCAAGTGCAAGGCGATAACCTACAGCTCCGAGAAGAGCACATTT
TTAGAGGGTTTTTAACAAGCAGCCTGTGGCACTCACTTGGGTGCATGAGAACGCTCAGAGCCGGTGGGCATGTCCGGTGGTACCGGTGCGAAAGTTTCAC
TCGGTGAAATTCAGACAGACGAGCGACTATCAACCAGTCATGGAGATGATTAACTCGATTGTTGGCGTCATGCCGAATCTGAACGCGGCTCTGGAGCACT
ACAACGGCAAAAAGTACTGTGATGCGTTCGACTCTCTCAAGCGCTTCTGGCAGCTGCCGCTCGCCAGGAAGAGCCAAGAGATCGTGTCGTGCATGACGGA
CAAGACGATCTTCACTCCGACGCGCGTTCTTCAGGGCTCAACAGACGCCGCGCTCCTCTTTCAGGCGACGATGGAGCGGATCTTGGACGAGCTGCTTTAT
AAGAACGTGCTGGTGTGGATCGATGACTTGCTCGTTTTTATGGAATCGGTGGAAGATCTGGTGTCAATGCTGCAGCGAATGTTCGAGCTGCTGGACCAGC
ATGGCCTCAAGCTCAATCCCAAATAAGTGCGAGTTGTTCCTTACCGAAGTTAAGTGGTGTGGTCGAGCGATAAGCGCCGAGGCGTCGGCCACGACCCAGA
GCGAATCGAGGCGCTCCAGAAGATCCATTATTCGGGAACGGCTGCCAAGCTGCAGCAGTTCGCGTGCGCAACCAACTGGATGCGTGAAAGCCTTGTCGAC
TACATGCGGGTGGTAGGCCCACTACAGCAGCGACTGGAGGTCGTGTTGAAAGGCATGAAGCGGACGAAGACGGCGGCTCGTGTGCCACTCGAGCTCAGTG
ATGAGGAGAAGCTGGTTTTCGACAGAGTGAAGCAACTGCTCTCTCACTCAGCAACATTGACGTTCCCATCCCGAGCAGCCAGATGCCCATGATAACGGAC
GCCTATGACAAAGGCTGCGGTTTGGTCGATGTGCAAGTTTCAGACTGGAAGCCGACGACGGCCATCCAAGAACAGAAGCACGAGCTGCTCATCTGTAAGG
TGGGGCGTTCAAGGACTTATAGTTGAACTGAACTGTGTTGGAGAAGGAGATGTTCCCAATTGCGTACGCGTGCGAGAAGTTGGAGTACCTGCTGCTCCGA
ACTCAAGGCTTCAAGATTTACTGTGACCACCGCAACATCGTGCACCTGTTCGCGCCAGTCAAGGAGCTCAAGAAGCACATGCTTGGGAAACTTCTCCGGT
GGTCTCTCAAGCTGCTCGAGTACAAATATCAGATCAAGCACATTGACGGGCGAAACAACTTTGAGCGGACCTACTCTTGCGCTGGGGCGGCGTCGGGTGC
CTCGATGAAGGCCTTGATGAGGCGCGTGGGCTCGCAGTAGCCACGCCTGGCGTCGATCCCTCAGTGGGCGACAAAGATTAGCAGAATGGATTTGGCGCTT
TCGGCGAGAGTGCGGGACTCAAGCTGAAGAGGATCACGTCGAATTGTCTTCCACCGAATGGGCTCAAGTCAAATGTTCTTCTACAGAATTGGTCCATGTC
AAATGTTCTTCCACCGAATATTTCCGAATTGACGGAGCTCAAGCCGGATGGTGGTGCGCAGGCCCAGGGCCAGTCTGATGCAACTGATCTCGACAAGATG
CAGAGCTCAGAGGGACAAGCGGTAGCACGCACCAAGAAGCTGACGAACCAACGCAAGACGACGCCTCCACCGATCCGCCCGCTCGGCAGCGAGGGATTTG
AGTGGCCGATGCTGGGCAAGACAGCCCGCGTTCAGTCTAAGCGCACGGCACCAGCGACAGCGATCCAGTGTGGCCATGGTGTTTGGAAGGTTGGCATGCG
AATCTGGATTCCTCGCGGCGGGCGCGAGCTGCTTGAGCGACTGATGGTGGTCCTTCACTGCAGCTACAGGACACCGCGGCGTGGAGGTCATGCGCAACCA
GATCCAGGAACTCTTTCAAGTCGAAAATCTCGCCAAGGAAACGCAGCGCTTCTGCTCCGAATGCCTGCTTTGCCATTAAGTGAGAGGGGGATCATTCCTC
GACCGTGGAGTGAGACGCATCACTCGCACCATCGCAATGAAGCACTTCAGCACTGGGGCTTCCTGTATCTGGGCGAGAGTTTCGAGGGAAACAACTATTT
GCTGGTGCTGAAGGACGCAGTGACTCAATACATCGAGCTGATGCGATGTGAGAATCCGACAGCAGAAGTAGCCGCGAGCACGGTGCTGGGTTGGTACAGC
AGATTCAGGTTGCCGAAGATGTGGGTGAGCGACTATGGCTCCCACTTCAAGAACAAGGTGATCGCGATGCTGTCCAGCAGACTCAAGGCTAAGCAGGATT
CATCGTTGCGTATGGTCCCTGGGAGCACGGTACTATTGAGCGCGTCAACCGTAACATTCTCCAGATGCTGCGAGCGCTGATTTTGGAGTACAAGATCAGC
CACCAAGACTGGCCCTACCTGATCCCTCTCGTCCAAGCCAGTCTCAACCATTTTCATGTGGCGTCCCTGGCGAACAAGGCTCCTGTCGAATTATNNNNNN
NNNNATTGGAGAGCTCGTCGCCATTGACGGCCATTATGAACCCGGAGAGCATCGAGAAGATCGTTGCAGTGGACTAGTATGGGGTCAAGACTGAGGAGAA
GCTCTAGCAGCTGCGCGAGGGCTTGCAGCAGATGCACTTGGCTGATTGATGTCAGAAGGAGAAGCAACTGCAAGCTACAGCAAACTGCGGGACAAGGGCA
GGGGTGTCGAATTTTCGCTAGGAAACTTCGTCCTGAGATCTCGAGTTGACGCCAAGAAGGGACCTGGCAAGTTGATCGTGTCATGGGTTGGGCCCTACAA
AGTCGTGGAAGCTTTGGAGTATGCGTTCAGGGTCGAGCATTTGCTGTTCAAGGAGCGCGTGGACGTGCACGCGTCAAGACTCATGTTCTACCACGATGCT
TCGCTCAACGTGATCAAGGAATTGATCGAGCATGTTGCAGTCCAGGACCAATTGTTCGGCGTCGACAAGGTTTGCGGCCACCGGCTCAACAAGGACATGC
GCGCGTTCGAGTTGAATGTGAAGTGGCTCAGCTTAGTGGAAGTCGAGGATTCCTGGGAGCCTCTTGACGGC