Description :
From Genome Similarity Track
Location :
Scaffold_2172:4- 3046
Sequence
3042 bases(100 bases per row)
GCGTCGCCGACATTGATGTCACATTTGACTCCGCGGGTGGCGCGGCTGGTAATGCATTACCTTTACCAATCAGCAAATGTCGGCTTTCCCAGATTTTCTG
ACGTAACCGATCCACTTCCGCGGGCTCGTTTGCCCCTGGATCCACTTGGATATCGTCAATTGTGACCTCCTCTGTGGTCAGTGGCACCTCCGGGATTACC
GCCAGGCCATCCCCGAGATCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAGACTTGTTCATCTTCCGTCTTCGTCGGATCCACCATTGGATCCAAAC
ACCGCGACCTGGCAGTCCTTCTGTCTTCGCGGGAAACATGGACACCTGTATATCAGGGAAACACCCAGTTGGATCTAGTCGGTCCTCTAACGAGTTTAAG
CCCGACCGTTCTGGTTTGACTAGTGTTGCCACTCTCGATAGGGATTCAGGCACTTATCCAATGGAAAGCTTGGATCCACTTGTGAATCAGCGGGATCCGG
CTGTTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAGGGGCCGACTCTGGGGATCATCCCCGGTCTTGGATCCAACCTCCCTT
GCTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTGGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTGCGCCGGGAGCTCCA
CCCCTCCGAGGGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGTCTAGG
GATACCGTCCTTCGCTAACCATCGCCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTATCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCT
GGCCCCTGGATTACGGTAGGTACCCATTTCTCGCCCTGAGTGACCCACAGTTTCTCATGTTCCACCCACTTTAACCGGTCTGGCAGTTCCCAGGTTTCCC
CGGGCTCGATCCAGGTTGTCTTATCCGCCCTTATGATCCTCATCTTTGCTCCATACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAA
AGAAAGTGTCCCATCCGCTAGATCCAACCTCACTCCGGCCGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATG
TCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATCC
GACTCCCATCCACTTGGCATCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTT
GATCTTGCCCCCTACCATGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCGGTTAGCAGATCCATGGATCCAACA
TCCTCAGATCCACGGGATCCAGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGCTTCT
CCCAATAACCACGTGCATCTCCCCTTTGTAGATCCATGGTTGAAGAGATTTCGGATCTGGCAACTCATCCACTTGGCGCAAACTAGAGATCTTGGCAACT
GACACTTCATGTAGATCACATGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATTTCTTGTTCACAAATGCATAAATGCAATACCTAG
AACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCGTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAAC
CATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGAT
GGCCTTTCTTGCTACACTTCTCACAGACCAGGTGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGTGAACACCTGACTTGTGCTGCCCC
GTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACAGTATCCCCCGATCGCGAGTTGTCTTTGGTCTTCGCCGTTCGATCGTTGGATGCG
GTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGATCCGTCGGATCCTGATTCAGTCCCTGAGTCAGGCGCCGTGACTTGGTGGACACGTCGAG
CTGGAGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACCTC
TCAAGCTCGTCTGCGTCGGGAAGTCGTACAGGTCAGCCTGTCGGCCATCCTTGATCTTCAATTTGGCCGTAGACCGGCCACATTTAGTCGATGTAGGTAT
TCTAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCCAAGCCACAGTACTGGGTCTGGAAACTGCGCAGCAAAT
CTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAACAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGA
CGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATG
GCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGATCCGGCTGTGGCTGTTGCTACCACCGCTGATGAAGGGGATGGGCCATCCAGATCATCTA
GGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCGCTTGTGGCACGGGCGCTCT
CATACCCTGTTCGACCAGGAAACGACTCATCGCAGCTTCGAA