Description :
From Genome Similarity Track
Location :
Scaffold_1671:4- 2677
Transcript NameFunction/comments
Phymu_g13533hypothetical protein PHYSODRAFT_261658

Sequence
2673 bases(100 bases per row)
GCACAAGCATCCGAttcaacgagaagaactcCGATCTCTGGCACAAGACTAGGCACTGCATTATTTTGAAACACGTTAGGCTTGGATATAACTCTATCCC
CCTTCAAAACTATGATATATCGACTCCACCGAgttgcgctgcttcgagcgctgctgcatctcggATTCGCTTAgttggtgctgttgttgcgGATGTAGTA
CGGGTCGTTCATGAACTCCTCCTCACAGTACGGGAACTGCGTGTCATCGTCCGACGGCGCGAACAGGTGCTCGCCGGCGTGGATCATCACGTAGAAGCCC
GTGAAGGTGCACACGATAATCACAATGATCGACGCACCCTTGTCCAGGATCGACATGCTCTTCCAGGACACGCGCATGTAGATAATAAGCGGCATCAGCA
GGCAGCTCGTCGTGTGGGCAGTAGCACCCGTGAAGTCCTGCAGGtcgatgaagcgcttgcgCAGCACCACGGCGATGATCACGAGGATAGCAATGATCGC
AATACGAAGAGCGATGTAGCGCAGCGGGTTGTTCTTGTACGGCGCgtgaagctcctcctccgtgatctCCTCACCGAACTCCAGAGCAACGCGCAGGTGC
GACATACGgccctccgtcttctccaccagacTCGAAGCAGACACCTGACGGTTCGCAGCGTCCAACGGCGTGGAGCTCTGCATGTACGACTGCTTCTCCT
GAAGCTCCATGTCATGGTCAACGTTGGCCTGGTCCATCTCGCCATTGAAGCGGACGATTTCGGGGCCCTTGTGCATTCCCAAGATCAGACGCTCCGCCAT
GAAGAACGGAGGCATCATGAGcgtcgagaaggcgatcgaAATGTGCATCTGCATGAACAGGTACGCCATCACCACAGCACCACGGTCAGCGGAGAAGCCC
AGAGGGGCCAGGCCCAGCGGGTCCGTCGTGCTCACGATCGAGTACAGGATGTTGCCCGAAATCTGGCAGCCACCGGCCGTGTAGCCGGCCAGAGCGATAG
CAACGAAGAAGCCCGAGATGAACAGGATGGTGATCACCACGACGCGAGGCATGCGCTGCGGCTCCGAGTGCTCACGCTGAAGGTCGGGCACCACAATGGC
AGCGCCGTAGGCCAGAGCGAGGTTACCGAAGCACGTCAGCACCTGGTGAATGGTGATATCGGGCGACGGGATCGATCCGTGGCCACGCATGTTCCACTGC
AGCAAAATCACGGCAATGATGTCGGCGATAATCGTGCCCATGCAACCGGCGAACGCCATGCCGGCGctctccttcagcgtcgggATCAAGCAAACCGGCA
CAACCATgagcgccatgaagatgatCCAGAAGGTCTGGCTGAACGAGTCCGggaacagcacgtccagcagagTGCTGCCCAGCACCAGGAAGGCGATCGG
CACCAGCAGACACACGCCCATCTGAGAGACAaccgtgaagaagcggccCCACTTGCCCAGGGCCCACTCACCCAGGTCACCGTACGTCCTCACGGACGac
ggcgccaccagcatcaccttGGACAGCTTGAGCGTGGCGTAcgtgttggcgaagatcATGAAGGCAAGGGCGATGGAGGCGTAGAACGGTCCGGCACGCG
CGTAGTTGGAAGGCATGGCCAGTGAACCGATACCGCAGACACAGCAGAAGAGGTTAAAGGacgccttggcgtcctccatggtgaagaaggcggacTTGGC
GTTCGACATCGTAGTGAGACGAAGGAAGTCGAGCGAGGCGAGGCGAGGCGGACTTCTCCGTTCGAGGAGAAATTCCAAAGTGAGCGATCTCAACCAGCTC
GCGGACGATTTTCAACGAGCGACTTGACTAATTCTCTCTCCGAGTCCGCCGCTTGAAGACTTGCCTTTCTCGCGCAGGACTTTGGTTGAACTCGCTCGAG
CAGAGCCGATGCGTTTGACGCATACTGAGCGCAAGTGTTCGTGACTGTGCCAGCATTGCCGGGCCCAACTTGGCAGCCAAGTCTTggctgtacagtaccg
gtagccTCAGTGCCAGGGATTAGAAGCGGCTGAGGCTCTGTGCATTGTGAACTCATGTCCCTGCTTGTAAcaatttgctgttgcagcagagcagagcaAA
GACTTGCTGGTCGAAGATACGGAGCAACAcatgaacttcatggtgAAGGCACAGTACGGGCGTGGCACTTATCAAGAGGAATTCTCAGCGTAAGAAACAA
TGCGCAGTGCAGGCAACGCGGGTTGCCACTAAACACTTTCAAGGGTAGCCGCCCTACGGCATTAATACGCGCGCATGTATTAAAATAGTGCAGATGGCGA
TGGGCTTGCCACCTCGCATGTAGATACTGAAGGAGGAAGGATGCGCGGCGAGACGGCCATCCGTTAACCGAGACGGAGCGCTGCTCCTCCCCGCCCATCC
CAccgtgcagcagctcgcaggGTTCCGGTgcattacatgtactgtacagtgtaTATGTTGTACGCGCTGCGGCTCCTGACTGGAACACCGTATTGGACCC
ACCCTGAGAAGCATCTCCGTATTCGGTTTGTGTCCATCTAAAATAAGGCCGAGGACACGTAGGACCGCCATGCGCGCGGCCTCAAAGTGCAGCGCGCCGT
GTGCACAGTATCTTTCGCCCTACGACGACCAGCGCGTCACCGGAAAGGGGCTGGCTCTGCTCGTATTATTAAT