Description :
From Genome Similarity Track
Location :
Scaffold_2922:4- 2600
Sequence
2596 bases(100 bases per row)
TTCGGTATGTAATCTGACAGTTTGAAACAATCATTAAAAAATAAAAAATGATTTTTAGAGGTAACGTTCGCTCCAAATCGCCCAGACCAGTCAGTTGAGA
TTAAGCGCGGGGGGGGGGGGGGAATGCTCCGCAGTTCAGATCTGCCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACCAGAAATTGACGG
TAAACCCGTCCGTATCTAGTTCGCTTCCCCGACCTCATATCGGTGATCTTCTCGACTTCGAACTCGACGGCTTCGAGATCCACATTCCAACTATCTTCCG
GTAGGAGGACTTCGTCGAAGTCGACGCGATCGGATCCATCCACCGAAAGACGGATCTGCGGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGATAG
GTGTACTACAGGGAACAGGCGGTATTCGGTACCTGCCGTTTCCAGCTTTACCGCGTGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGG
TGGGCTAATTTGCGGGCATACCCCTCTTTCACTCGATCCATATAAAGCCACACCTGTGATCCCACTTGGATTAGATGTGGACGGGCGTCTTCGTTGTGTC
GATCCGCTCGACCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGTCTTGAATC
TCGGTTCCTCTTCTTGGTGCTGCAAACTGGGATTGCCGCTTCCAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGTGTATCACCCCGGATC
CTGTCTTGGGCGGTGTTCATCGCGAAGGGAAGCCGCTCTGCGTACTCATCCCAATCCTTCTGATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGA
TTGTCTGCACCATGCGCTCGGCCGATCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAA
ATCGGACATAAAGCCTGGCTCCCGATCATGCCTAATCCTCTCGCTAGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCAGCAATGGTTTGCGCA
GTTCTAGACGCACTAGCTTTGGCTATCACGTATCCGGTAAACAAGTCCACCCAAATCAACAATTCTGAGTTTCCTTTGAACGACTTGGGCAACGAGGGGA
TATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCAC
ACATTCCCCGACGTATCGTTGTACGCTCTTGAATAGTCCTCTCCAGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCT
TCCAGGCTAGCATGGTAGTGGTGTAGGACATCCTGTTGCAAGGTTTCTGGCATCACCAGTCTCATCAATCCATCCCGGTCCTCGTTGACTCTCTTCGTAG
GGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATACTGTATGATTTGGTATCCTCCCGACTCAGGTCTCGTACATCCCC
CATCAGATACTTCTTTAGTCCCAAGATCCACGCTTCCTCGTTTTGTGCTTTGAGGATCCGCTCGATGCGGACTCTCTTCACAAATGTTTCCTCGAGAATT
TAGGGGTTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGGACTGTCCTTTTCCCGGATCCCACTACCACCACTTCGTCTAGTCGGTTC
AACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCAACACCACATCGATTCCGTAAAGCGGCGCTGGCCAAGCTATCTGCACTGGCATTCCAAT
CTCGCTTGACATGTACCAACTCGTGATTCATCCAACCACGCAGGTGGACCATCACTTTCTGCCGTAACAGTGTTAGGGCAGGGCCTTGCAGGCAATCTCA
CCTCGTACCTGTCTGATCACCAAACTTAAATACCCACAAATCACCAGCCTTTTCGGATCTTGTCCCTTTAGTAGATCCAAACCCAGCAGTAGCCCGTTAT
ACTCCGCTTCGTTGACGGTGAGGCCTTCCGCATAAGTGGATCTGGCCCGTACTACTTCCCATCCAGGTAGTCTCCACAGTATCGCACTGTACGCCCCGCC
TCCGCGTCGTATGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCGTCTGCCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCT
TTCTTAGGAGCGACCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGTGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCCTCCCCTTTCGAACATT
TCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCTTTGTAACCCGGCTGACTTGAACAGCCAGGCTAACGTAGAGTGTCG
AGTCAGGATCCGGATGGATCTTCCCACTAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTT