Description :
From Genome Similarity Track
Location :
Scaffold_2770:4- 2581
Sequence
2577 bases(100 bases per row)
ATAGGTCGCGAGCCTGCATCTGCGTGTGGACCACCGGGCCTCTTCTTCCGGTCTGACCGAGGCCTTTCGCATGATCCGACGAATCGAGGCTTTGTTGCCA
CGTACGGAGCCGCCTGCGGCACACTCCCAGACGTACGCGTATGGTGCGTACCCGGCGTACTCAGCGTACTCGGCGTATGGCGCCGGGGTCCGTTCGTATG
GAGCCCCTCCGGCGTACGGTCTTGACCGCAGCCTTGCCGTCCCGACCGAGGCTTGGGCGCCAGCTCCGACGTCCTCGTCGACGACTGTGATCGGCCCTCG
TTTCGAGGAGCTGTGTCAAGGGGGCCTGCGAGTCAGCAACCCCCTGCGGGTCAAAGTACCGCTTAAGACGTCCAACATAGAACGTCGGGTGCGTTGTCAT
TGACTTTGGCAGATCGATGGTGTACGACGCACCATGTCTGGCCAGGACTGCAAATGGTCGGATGAAGCGGTGTTTCAGCTTGTAGCTGCCGACAGAGCTG
ACAGTGTCAAGCGGTAGGTTCCTCGTGTCTAGCAACACTAAGTCCCCAGCCTCAAATATACTTAAGTTTCATCTTCCATGTTTGTCTGAGTACTCCTTTT
GTTTATCTTTAGCCGCTGCCATGGCATCGCGGACCCTGCTGACAATGCTCAGCGTGGTATCCATAAAGGATTCCACCTGTTTCCGCAGCGAAACTGGTCT
CACACCCGAGACCTAGGAGGAAAGGGCTTTCCGAGCATCTCCCCCACTTAGAATAGAGGAGTCAGTGTCTCCTCGAAGAGTGAGAGGCACTCTGGGGTGG
CGGAAGCCGTTCAAGTAAAACGGTGTGAACCCCGTGGACGCGTGCACCGCGTTGTTGAGCGCAAACTCAACAACTGGAAGCTGCGTCGACCACGTACGTG
GTGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACACGCTCTGCTTGGCCGTCTGTCTGCGGATGGTCCGCAGTGGACATCTGCAG
ACGAGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAACGCAGCAGTGAACCGCGGGTCTCGGTCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGGAAC
ACGCCATCGACGAACAACCTTGCGGTTTGTTCGCAAAGATGTACCATCTTGCTCAGCCGACACACGAACACCAAAATTACGGTGTTGCCGTGTCCGTCGG
CGAAAAGCCCAAAGATGAAGTCAAGACTCATCGACTTCCAACAGTCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCGAAGAGTGGTCTGCGGGTTTGAC
CCGCTGACATGTTTCGCATGTCTTAACGTACCGGGCGACCCACTTGTACATGTGGGTTCACCAGAAGAACTGAGAGATCGACAGAAAGGTCTTCTCGCGG
CCCAAGTGGCCGCTGGGGGGCGCGTCGTGCGCCTCCGCGAGGATGTCGAACTTCAGATCCTCTCCGTTGGGTACGACCACCCGTGGAGGATCGGTCGGCT
CCACCCGGTAATAGAGGAGGCCCTCCTTCAACTCATATCGGTGGAGCCGTGAGCGCTGTCCCGACGAGAGCCAGTCGGACTTCGCGCTCGCTCCGGCCAT
AAGGAACTTGACGATAGGCGCGACAGCCTCATCGTCCCGATACGCCATGCGTATCCGATCATATAGATCCGTTGTCACCCGTGTGATGTGGGCCAACTCG
TAGTCTGGACGCCGAGAGAGGGCGTCCGCAAGCACGTTGAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTGTACTCCGCGAAGTAGGACAGCCACGTCC
CCATCTTTTGGGAGAGATGAGGCGAGTTAGTCGCCGTCCTCAAGGACGCGTGGTCTGTGTAGATCACGAAGGGCCGGGAGCCCAGAAGGTGAGCACGAAA
CTTCACAAGGGCATATTTCATTGCCAGGAGCTCCTTGTCGTGGACAGGGTAGTTCTGTTCGGCGGATTTGAGCTGCCTGGACTGGAACGAGATGACTCGA
TCGTGTCCAGCCGTGTCGGCCTGCAGCAATGCACATCCGATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGGCTTCGTCTCGTCCGGCAGGGCCA
GGACAGGGGTCTCTTGGAGACTGGCCTTGATGCTGTCAAAAGCATCCTGGTGCTCCTGCTCCCAGCGCCAGTCGGCGTCCTTCTGAAGGAGGCTCGACAA
GGGCTTAGCGAAGCCCGCGTACCCTGCGCTGTACTTGTGAAGGTTGTTGGCCAAGCCCAACCACTTTCGAAGATCCTTCTGGGATCGGGGCGTCGGCCAT
GCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGCCCACGTTGCTTACGAAGCAACTGAGAACTTTGGTCTTTGGTGACGCGAATACGCACTTGT
CGATGCTGGCGTAGAGCTTGTTTGCTCGCATTACGTCCAACACTCGACGGAGGTGTCCTAGATGCACCTCCATGGCCGTCTTGCCTCCCTCGGCACGGCT
ATGGACGAATATGTCGTCGAAGTACGTCTGTACGAAGGTACGCAAAGGGCGGAACAATTGCGTCACCAGGCATTTGA