Description :
From Genome Similarity Track
Location :
Scaffold_350:4- 2530
Transcript NameFunction/comments
Hyaar_Emoy2813846hypothetical protein

Sequence
2526 bases(100 bases per row)
TCTCAATATAATTTGTCTTCATTTCCATTCGATCGCTCCCATAAATCGTCTTTCTTCCTTTTTTAGTGTCTATTCGTCGTGATCGCACCATTTGGTCTGC
GATCACCGCACTCAATTCACGCAAATTTCATTCCATCTTCATGTACGACACCCTTACACCCATTACTCCCATCCCCTTCCATGAACCTTCCCTGCATATA
CCCATCCACTCAAGTTCTTCGATCATCGCTAGTCTCTGGCTTCTTCTTCGTTTGATTGCATCAATTCAAAACAATTCCTGCTCACCTGATCGCTATCAAA
CTCCTTCAACATAGCTCCACAATTGAGATCAGCTTCATCAATCCAGGTTGGGTCGCTGTACTACTTCCATTAAACCAGGGTCTGCTTGTGTATTCGGCCA
TATATCGTGTTCCGTTCCAATCGCGCATCAAAAATCTTATCCACTTCGAACTCGTCTGCATCGAGATTACCATCCCAACTATCTTCAGGCAGCAGGGCTT
CGTCCAAATCGAGACGACTTGCCTCATCCATGTTCAACTTACTTGTAGGGCGTTCTGGGAACACGCAAACTAGCTTCAACTTAGAAATGTGAATTATTGG
GAATAGCCGGTACGGCGTACCCGCGATTTCCAACTTTACAGCGTGATCGCCTCACTTTTCGGGCACCCGAAAAGGTCCATGCTACATATGGGCTAGCTAC
CGAGCATATCCTTCCTCAGTTCGGTCCAGGTATAGTCAAAATCGTGACCCGCGATCGATATCCAATACATCTCGATCTTTAATATGTTAATCGCTCGAAC
CTTGATGGCAACCTCCAATCGGTCATTCACTACCGCCCGTGCACGCTGATATTGGTGTTGTATGCCATATCTCCACCTTCGTGCGTCTCAATCTTGAGGT
TTAGTGCTTCCCAACGGTAATGTGGCTTCTAAGGTTGATCTTGGGTCCCAACCGTGAATTAGGTAAAACGGTGTGTCTACACGAATTCGATCATAAGCGA
TGTTGATCGCATAAGTCAATCGCTCTGCGTATTCGTCACAGTCCTTTAATATTCATCCATGACATACATCTTGATGGATCGAGTCAGTGTCTGCACCATG
CGTTCGGCTGTACCATTCGCTTGCGGCCTATATGCCGTGGTGGATTGCTGTTTTGTACCACGATTCGATTAAATTCTCAGAAGAAATTGGACAGGCTTGC
GATCATGACGTATCGCCTCGCTCGCAACGAATCGTCTGAACACGCATTCCTCGAATTTTTCACGATCTTCTGTGCAGATCTGGACGAGCTTGCCTTTCGC
AATCACATACCCCGAAAATAGATTACCCAACAATAGCAGCTCGGTGTTTCCTTCAAAAGATCCTGGCAACGAAGGTATGTGATCCATAGTTATAATCTGA
AAGGGGTTCGTCGATTGCAACTTACCAGGTGGTCCGCTCCGATCACCTGGTCGTCTCTTTTTCTGTTTCAAAATTCACACACTCTACCACATACCGCTAC
ACACTTCTGCACAACTCACGCCAATGCAAGTTCGCCCTGATCCGTTGATAAGCGCAACCGATTCCTTGATGAACACCCTACAAACTTGTGTGGTAGTGAT
GCAAGAAATCTAGCTGTAACTGCTATGGAACAACCAGACGAGCCACTTCAGTACGGTCCATCGATTTGATGGCAGATCAAGGACGGAAAATAGCAATCCA
CTTTGGTCTACTTCATAATCCCGTGCGATCAGGGCGAAAACTTTGGCTTCAGTCGACGACAATCTAGCCTCATCTCCAACCAGATATATCTTCAGACTGG
ATATCCGTTTTTCTTCGTCTTGTGCTTGCTTAATGTGATCGATCTGTATCCGCCGCACAACTTCTTCCTGTAAAATCCTGGGCTGAAATTGTCCTCTTAG
AGCTGATCGAGTGATATCCGCCATTTTTACTGCATGATCGACTCGCTCTGGTAACAGTCATTATCCTAAACGATTGAGAGTGATCAGGTCTTGACGATCC
TGATCCGAAATGACAACTTTTCCTTTCTCTTGCCTTAGAGCTTCACTCGCCAGCCGATCTGCACTCTGATTCTACTCCCGCTCCATATGCAGGATTTCAT
GGGCTAGCCACGATCAGAGTATCCCCATCTTTCTCTGTCTCATCAATAGCAGTCTTGGTGCCTTACAATCGATTTCTCCTCGTAGTTTGGCGGATAACTA
AATTTAAATCTCCGCAGAAAATCACTCGTACCCTGGCCTGACCGGCAAGCAAATCGAAGTTGATAAGTAATCCTCGGTATTCTGCTTCATTCACGGTCAG
ATCAGGGGTAAACTCGGAAGCAGCCGCTAAAAATGTCCACTCCGGCAATTTTCATATAATTGCGCTGTATGCTCCGCCCTTTCTCTTCACTCTAGCCGAT
CCATCGAAATTGGCCACTAGCAAGTTTTCATTTTTTCCTAGTAAAGGTGGTGGCATTCTTATCGTCTGTCTTGTTTGCTTCCGCGGTGCAATCGCAATCA
GTACCTCATCCACTTTTGATCAAGGT