Description :
From Genome Similarity Track
Location :
Scaffold_412:4- 2510
Transcript NameFunction/comments
Phyra_85998reverse transcriptase

Sequence
2506 bases(100 bases per row)
GAGAAGTACTCCAACAGTGCTTCGCATCCGCATCATGCGCGTATGCGGCCTTCACGTCATCCAACAAGGACGATGAGGGTGTAGTCGTCCTGACGACGCC
AACTGCGTTGACGTCGGCCTCTTGCGCCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGACATTCAACCTTCCACGTTTGTACTCAACCTGGAAG
TTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGA
ATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCGCAGCTGGCTT
CAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGTGAAATCGGACGCGTCGCACACAACG
TGGAATGGGCGATCTTGGTCGACCACCGCCAAGATCGGCGCCTCAGTCAAACCCGCTTGACTGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCA
TGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGC
AGTTCTTGTACATTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGG
GTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCATAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTT
CACATTCGATCTCCCATTCACAGCCCGGCTGTGAATGAACACGTCATCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCAC
CTGTTGAACGTCGCTGGGGCGTTCATCAGCACCTGCGGCATTACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCTGTGAGAGGGATATCAC
TCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCGTTTCGAGGTAT
CGGCGTCTGCGCCGGTACCGCCGCATCGTTCAGCTTGTAATAAACATGAACGATGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTG
TGCGGGGACTTCGATTCCCGCACTTGTCCTGCCTTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCG
TGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGTTGAACACCCTTATCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTA
CTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCC
TCACAGATGAGCTGATCCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCTAGAGGATACAGATCTACTCTATGCGTCCATCGTGCAGGTCGCGAG
CGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACACTAACGTCGGAGGATTATCCAGCCTCATCTTCTTGTATTGGAGACCAATAATCGT
GCGCGTCAAGACACTCAATGTCTCGACGGTCGTCTCCAACTCCTCTGTCTGCCCGGCAGACACTGCTTGTAGCGTCTCGGTCCCTGACCGAGACTTGCGC
AGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGACCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGC
CGGCGGGTTTTAACCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCGCTTCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGG
TGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGCCTTCTTTACCTCTACGCCTAACGGCGGAGTGTCTTTCGACA
AATTGTGTGTCGACATTATCTGTCAACACGACGGCGTCGCCCCGGACGCTTCGAGACCCTCTCGAATCCGATTGAACCAGGCCCTGCTGATTCGGTTCAC
ATCTTCTCCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGATCGGAGACAGCCGTATTCCGCGCTGTCTCTGATGGAGGGCCGCATGCACCGCG
TGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGTTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCAAATCGATCACCGGATCA
TGCTGT