Description :
From Genome Similarity Track
Location :
Scaffold_1013:4- 2282
Transcript NameFunction/comments
Phyke_g11814reverse transcriptase
Phyke_g11815reverse transcriptase

Sequence
2278 bases(100 bases per row)
GGCTAGTGTACCCAAGAGTTCGTCTTCACCCTTCGTGCATTTCACGATCTCCAACGTCCATGGAGATAatgttgtggagttggaaaattgtaaagtgaga
ttatgtgtttagactgatctactctctttcttcctaatcattcatttcctaaaggcttcacagccattcatgcaatgattacgcactgggtgagtagcgt
aatcatgttggtgttgtctacacaaaatatgtaactggtgggttttgaacccacgccactcgggtaacctgataccctcttaaccacttggactaagtgg
ttgcttcttgaaagtagtgaaCTATGACAGATAAGATCGCAGCCCATCGTCCAAGTCGGCCCTGAAGTCCTGACGAGTTCACCAGCCAAGCCAGTGTCGA
GTGTCGAGTCAATACCTTGATCGACCTCGATACCAGCTGGGTATAGCAGACATCAAGAATCCGAAGCAGGGCCAAGACTTCCTTGTCGACGATCCCATAG
TTGAACTCGTTCGACTTCAGCGTTCGACTGGTGAAGGTCACTGGCTTATACACGCCATCATGCTCCTGCATCAACGCAGCGGAGATTGCCCACTTGCTCG
CGTATATCACTGCGACCGGAGTTCGATCCGGATCGAAGTGTTGCAATATTGGGACAGTCAcgatcttgttcttcagtATGGTGAACACCACTCGCGCTCG
GACCCACTTGTCATTCTCATCGATCTGCAACTCGTCGCCCCCAGTCTCGGCACTTACCGCCTCGATCTGATCGCGTCGATCTATCTCGTAAAAGTCAGTT
TCTCGCAACTCGTACAAGATCGCCGCGTAGATCGCGAAGTCTTCGATAAAGCGACTGTAATAGTTGAGACTACCGAGGAACGATTGCACCGATTGCAATG
TACGAGGAAACGGCAAGTTAACCAAAGCATCGAGGTCCTTCGGATGCGCTTCAAGACCGTCTGCCGAGACACGGTGACCCAAATAATCAACCTTGCGGTA
GCCCCAGAAACTTTTGGCTACGCTGATCGATAGGTTTCATTCGTCATAGGTGTCCAGCATCCTCTCGACCTTGTTGCACATAGAGTTCCATGATCCAGCG
GCTACCAGGATGTCGTCGATATATGATCGTCGACCCAACACAGACGGCTTCGGATCGGGTTCTGGCTCCCCCACTTCGAATAGATCAACTAGCTCGGAGC
GATCCGTGCCAGCTGCGATCCGGAGGTAGCCGTACAGCGCGTTATCCAGAAGCCTCTGGTAGATCTGCGGAGCGTTCTTCAATCCGAACGGCATACGAAG
CCACTCGAAGAGCCCGAATGGGGTGATGAACGCAGAGACCAAGCGAGCGCGATCTGTCATCGAGACGACCCAGAATCCACTTGCCATATCCAAAGAGCAA
AACCACAATACCTTGTCCAAgtcttccagcagatcgttGATCAACGGCATGGGATATACCATCAAGCGTGTCAGGCTATTCACCTGGCGATAGTCAATGC
AAAGCCTGATGTCTACaccgttcttcttgatgatcacCACAATCGGTGATGCCCATGGAGATCGTGACGGCTGGATGATCTTTGCTGACAGGAGACTCTT
TATCAGATCGGAAAGCTTCTCTCGGAACTGTGGTGCGACCTTTCGCACGCGTTGAACAACAGGCTTCGCGTCACTGCACCGCGTACGGCTGGTGGCAATG
CATTCCCCTTGCCGACCAGAAGATATCGGTACCGCCAAATGATCTGTCTTAGTCGGTCGACTTCTTCCGGCGTATTCACCGCTAGATCGCCCACTTGGAT
ATCCTCGATGGCGACGTCTTCAGTAGTCGTTGTCACTTCAGGCAACACTGCCATCTGATTTTCAACGTCCTCTGCGAAGAGGTCACCACCTTCATGGAAA
CAGACTTGTTCCTCTTCAGGCTCTGGGGTAGCCAGTGGATGATCTTCAGCTCGATCTAGGTCCCTGCAATCTGTTGGCACAGTAGATCCCGGGTTGGCTA
TGTTGTCAAGACGACAACTCGAGTAGCCAGTGGATACCAGTAGATACCAGTAGATACCGGTATGGTATCTTCACCCAGTGGTACCGNNNNNNNNNNCGAT
GAACAACCTGATGAAGAACCGCCGGGAACACTCTTAGATCGACCTCAGTATGCTATACCGAAGGAGATCCTGACTCGCCCGATCGAATCACCGAAGCCAG
TAATGACTCCTGTGGCCATGGTGTCATCGACTCAAGTGATGAACCAGGACGTTCCGGATCTGAAGCGGGAAACACAGG