Description :
From Genome Similarity Track
Location :
Scaffold_1571:4- 2256
Sequence
2252 bases(100 bases per row)
CATGAGACTGACTTGGTTCCTGGAACCAAATACTGTGTTACAAGGCAGTAGCCTTTACCAAAGGAACAACGTGACGTCATTTAAGATTTCTTTCGTGCTA
AGCACGCGGCGGGAATGGTTTGGGAGAATAAGTCTCCTCATTCCACACCAACGTTTTGTTTCAAAAAGCCTAATGGTAAGTGGCGTATTGTGCATGCTTA
TAATAAGATTAATGCGGTCACTGCCACTGCCACCGGCACAAACACCCATTCCTAGAAAGGACGTTCTTCAGAACAACATGGCAGGATGTACAACGTACAT
AGCACGCGACCTGGTCAATGGTTATTATCAACAGCTCATGCAAGCAAGTGATATCCCGCTTACAGCTGTTAGTACTCCAAGTGGTATGCTTTGGGAGTGG
CTGGTTATTCCCCAGAGGCTTTTCAATGCCCCGGCTACGTTCAATCGTCTGGTGACGCAAATGTTCTGCCATCACCGTGCGTATGCACATACATATTTTG
ATGACATATTAGTCCGTAGTCGGGCGGAACAGGGTGGGTCGGATGTGGATAGCCAGATCTACCATTTCGAGCTGTGCTCGAGTGCATGCGCACTAATAAA
TGGTACGCCGACGCGTCTAAATGCATTTTTGGTGCAGAGAAGATTCCTTTTCTAGGATGCTTCATTGGGAAGCGCGGCCTTAGAGCGGATCCTGCAAATT
TGAAGGCCATAGTGGATTGTCCAGTTCCTGAGAATCAAAAGGACCTACGCAAATGGCTTGGCCTTGCCAATTACTTGCACAAGTATGTAGATAATCACGC
TGATATGGCTCGGCCATTATCTATTCTCCTTAAAAAGGATGTGGAGTGGTGCTGGACTAGAACCGAAGCAGAGACTTTTATGGCCGTAAAGGAGATTCTC
CTACATGCCCAATTTTGGCTTTGTCAGATTCTGATCGGCCTTTCAGTGTCGTCTGTGACGCTTCGGATTTTGCCATTGGCTGTACTCTGTTACAAACAGA
TGTTGAGGGACGCGAGCGTGTCATCGCTTTTGAACCCCGTCAACTTATAGATAGAAGTACTATCCAGTTCACGGCAAGGAGCTACTTGCTATGAAGTATG
CTCTAGTCAAATTCAGAGTTCATCTGCTTGGCACTAAGCCTTTTGTAGTCAATACCGATTATGCATCTTTACGCACAGCGACCCAATCGCCTCACGTCTC
GCAGAGAATGGCGCATTGGCTCTCATCCTTTGCAGAATATAACTTCGAGGAGAAATATAATCCGGGGAAGCAAAATACGCTAGCTGATGCGCTGTCACGA
CGGCCAGACTACGAGCATGCTCATGTTACGACTTTGTCGTCGTCAATTACTGACTTATTCCGTGCATATCATTTTAAGAATGAACAATGTGTAGCCTTGC
TACGTGCTCTTGGAAGCGATGAGTTTAAAGACTCGGACATTAAATTTTCGGCACGTTCGCGTGCGAGGCTACAACAATATTCTATCGATAACGGCTTGTG
GTGCTATCGCACGGATGCTGCGGATATCCCGCGTATCATTGTTCCTCATGATGAGGAACTGAAGTATCGAATCCTCCATGAGGTCCACGACATAGCTATT
AGCGATCATCTCGATCGTGAGAAGACCTACGGCTTGGTTAGCCATAGTTATTGGTGTCCCAAACTCTATAAATGGGCAAGAACTTATGTGCGCATATGTA
TGACGTGCCAACGGGTCAAATCCTCGGCACATGTGACTGCGCCGCTGGCTAGTTTGCCTGTACCCTCTGGGTGTTGGGAGTCCATCAGCATGGACTTCGT
GTTTGGCCTACCGAAGGATTTGGATGGCAACACAGATATTGTGGTCTTTGTCGACCATTTGAGAAAAATGGCTCACTTAGCGGCTGTGCCGGATTCGATT
GATGGTGAAGGTACAGCTTTGCTGTTCATTCATCGCGTGATTCGACAACACGGACTGCCACTGGCAATTATCTCAGACCGCGATCCTCGTTTTACGGGCA
AGTATGGAAGTCCATCTTCAAGGTGCTCGGTACCAGATTAAACATGTCTACAGCGGATCATCCGCAGACCGATAATCAGACTGAGCGTGTCAATCGCGTC
CGTGGTGACGTCTTACGCGGCGTGTGCGCTGAGACGCCTCGGCGTTGGAGATCAATGCCCCCCATTGTTGGTTCGCTATGAACGATGCCGTCCATGCCTC
GACAGGCTATACTCCGTTCTACATGAACGGTCTCAAACACCCCCGTGTTCCG