Description :
From Genome Similarity Track
Location :
Scaffold_2026:4- 2134
Transcript NameFunction/comments
Phyag_g11922hypothetical protein PHYSODRAFT_246685

Sequence
2130 bases(100 bases per row)
accagcctcgagctccgcagttctgcagaggacaccgaatcgactaagtcggcttaattcaaaccaacgtgggaacgggaccctgagaaggacctcaaac
gaaagcccattcgtaaacgggctgctggggagtgcaaggcttagtgccttcattcataggtagcccagtccgaacgtaaagatctctcgagatcattctt
agtgaatataccataggTCAGCCTTAGCATGGGCGTCGTCCGGTGGTTGAGGTGGCATTGTCTTTCCCTGCCGTGGGTGTGAGAGGTATCATTCTCCTGC
CTCAAGCGGTGTGGTGTCCGCGAAAGAGGTGAATGTGTCATAAGACAGCCTGTCCAGGAGTTCGCTGCTATTCTAGGTGCTCAATGCAGCTTTTTCAGGG
CAAAGACCCAGCACCGCAGTTTGAGTGAACGATGAGCGCTGCTTCGCTATCGAATGGCCCTGGATCCGAATTGAGCTCGTCGGCAGGTCTCCGCGACATC
CATCGGCTGATCAGCGAATGTCACGCGGCACTCAGGACAGACCCGGCTTGTCTGCATACGCGTGCTGTACGAGGTCACGCATGCATGAAAGCCAAGCTTT
GGGATCAAGCGATTCAGGACTTTTCAGAGATCATACGTTGTAAACCGGACGATATCCACGGCCGGTTCAGTCGAGGTATGGCACTCTTCAAAAGCGGGCG
GGTGGATGAGGCCCACAAAGATTTTTCGCGCATTCTCGAGTTGAATCCGAACCACGTCATGGCGCGTTACGCTCGGTGAGTTGTGTCATAGTCAAGAATT
ATCTAGGAATACGGAGCTAATTGTCACTTTATCGCGTTAACAGTGCGGGCTGCTTTAACTCCGAGGGAGAATACAACCAAGCTATACAAGAGTACACTCT
GGCGCTGCAAGCAGATGAAAAAGAAAGCGCTGGCGGCTTCCGACTCGAAAAACGGCAGATTGGCATGCATGAAATCGCTGAACACCTTATTCGGAAGACC
ATGGGGGTCTCTGCACGCTCCCGTGGTGCAAGTCCTTCGCCACTACCCAACGAACGCAGATTATCTCTTTCTGTTGGAACTCTCAGTCGTCCTCTTGTGT
GGCAACAAGAAAGAATTGCCGAGCCCCCAGCCCAAAACGTGCGACCTCGTTCCGAATCTACTCCAACCAAGCGCCCGATAAGAGTTGTCCAGGTTCGTGT
GAATTTGAGCGAGTTCGCATCGTCAGCTCCTCAAACCAGCGTCAAGCCTTTAGCACCTGAACAAATTCCGCAAAAAGAGGCAATACCTATAAACTCCTGT
GATGGCATTTCgaatcaacagcagcaacctcaaGCTCCTCCTCGCGTTTTAGTTCGTGCAGTACCAAAGACAGTTCGTAGGGTCACAGTAGCACTGTAAC
TTTGATTAAGGGTTTCGGGCGCCGCAGCATCTGTTTGGCTTCTGttcaccagctccatcaaACTTTGTTGGGGCCAAGGGCTTGTGTGAGCACTGCGATG
TAGTCTTCATAGTAAATGCGTCCAGTTGGTGGATCCTTTGCAGCTGCAAGGAAGGCTGCACATTCGGTTCGTGAGCATGTAGAGAACAATGAGGGGATAT
GACAACGGATACcttccatctccttctctcgGAACGGAGTTCCTTTCGTGgtgagcagctcgcgcatGATCTCAGCCTCGATATATCCTTTCTTCTCAGT
GTCTATCACCTACTCAAGTGCCAAAATGTTGGAATCCGCACGAAATAAAAAACAAGAATAAGGAATGAACTCTTCCTTACCCGGAATGCAGCGAGAAGCG
TTTCGTCCGTGTCGGGTTCGTATTCGTTCGTGTACAGCACCTCCAACATCTTCTTCTCAAAGCGGTCGTACGTCACAAAGGTGGACGGTTCGTCCTCTTG
CATCTACAATATTTTTCTGCTTAGAAATTGAGTTTTCGAGACGCCGGTGGAGTGACTTACCTCGGGTAGGATCTTTTTGATGATATCCTTCTCCGTCGGG
TAAGCACCAAGGTACCGCATGATCGTGCTCACTTCTCTAAAACAAAATACATACGACATGTTATCCAACTTGTGTGGGCAACAATACTTCACCACAAAAC
AACAGAAGAGCTCTCACTCTTGAATGACAC