Description :
From Genome Similarity Track
Location :
scaffold_1783:4- 2112
Transcript NameFunction/comments
Pl_100342hypothetical protein PHYSODRAFT_522638

Sequence
2108 bases(100 bases per row)
AGACTGTTGGAAGTCGATAAGTCGCGATTTTGACTTCGGCCTACCGGCCGATGACCACGGCAACACTGACATTTTGGTGTTTGTCTGTCGTTTGAGCAAG
ATGGTGGATCTCGCTCCAGTACCCGATACAGCCAGCGGCGAAAGAACCTCTGAGCTGTTCTTGGAGTTTGTCTTCCGACGCCATGGCCTACCGGAGACCA
TTGTCTCTGACAGAGGCCCGCGGTTCACCACTGCGTTTTGGCAAACGATGTTCAACCTATTGGGAACCCGGTTGCTTAAGTCAACCGCCGACCATCGACA
AACGGACGGTCAAATCGAGCGAGCCAATCGTGTGCTCGAAGACACCCTACGCAGTTTCTGTGCTGAGGCACCACGGTTGTGGGCCAAGCGCGTTCCTATG
GTTGAGTTTGCGCTCAACAACGCGGTGCACGCATCACCGGGGTTTACCCCGTTCTACCTGAATGGGCTTTTCCACATGAGGGTGTCGCTCACTTTGCGTG
GGACCACCAAGGATACAATCCTAAGTGGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTTTGAGGCGAGACTTGCTTCGTTGCGGAAACGGTTGGC
AACAAACTGACTCTCATCAGCAGGGTTAGAGACGGCGGAAGACCAAGACAAACAGAAGGAATACTCTGACCGACATGAAAGAGGAAACTCAAACGTGTTT
AAGGTGGGTGACTTAGTCTTACTCGACACTAGAAACCTACCTCTAAACTTGGTTAGCTCCATGGGGAGCAACAAACTGAAGCACCTCTTCATCGGACCCT
TCGCGGTCCTGAGTAGACACGGCGCTGCCTACACAATCGACTTACCTAAGTCGATGACACCCACCCGACGTTTTATGTGGGTCGCCTGAAGCGGTACCAT
GACCCGCAGGGTCAGAGTGCACCGTCGGCAGTGATGGTCGACCACGTGCCGATGAGTCAACCTCTTCAACCCGAGGTTGGCTGTGAAGAGCCACGAGCTC
AGTCGACGGTGGCGGTTGCGAGTATTGACGACTATCATAAGCAAACACGAAAGGCTACTGGGCGTACGACGGATGTACGACTCGTACGTCGCGTATGAAC
CATACGAATGGGAGTACGCAAAAGGTTGCGACTCCACGAACGAGGGCTGATGAGCCACTCGGTACAGGACCCGGTGCTCCAGGTCCTCAGGGTCAGCCTT
TGTCGCACGGCGACCAACGGACAGATAGAGCCCTCGGACCTCGCGGTCCAGTGACTCCAAGTCCTCGCACAAACGAGGGCCAAGTTCTGGTTGGCCAGAC
TGCGAAGTAGCGTCACCACCAAGGCCTACACCAGTGACACACTCCACCGCGTACAAGCACTCAGGGAGTTGGCGGATCTCCTCCTCCATCTGAGCTAGTG
GCCGGTCTCGAGGATCAGCCGTATCCTCCAGAGCCACCTTTGAGGGAGGTGTCTCATACGAGTAGTCGAGAGCGGCCACCGCTGGCCCTCCTCGACCGGA
ATAGAGAAATCCACTACTACATGGAGCGTATCCTCCAGGAGCGGCGCTTCCACGGGAAGCGCGAGCTGAAAGTGAAGTGGCGGGGCTACCCGACTTCACA
GAGCTCATGGGAGCCCATCGTGCAGCTCCAAGTGAACTACCCGAAGACTATCTCGATATAGGTGGAGGACTGGGTGCTTCTCTTTAACCCTGTCGTCCGA
GGGATGAGTTGCCGCCTCGCGACGAGATAGGCGAACTGAACCCGAAGGTTCCGCTGGGGCAAGATGAAATCCAGCTCAGCTTCAGCCTGGAGCTCCTTGA
TGGGATAACCCTTGAGGGCGACTCACCTCCAGAACAAGGCTTCGACCTGTGCAGCCGTGGAGGTGTTCTCCGGCTGCACCCATCGGAACCCTACACGGGG
TAGAGGACACCTTTTTTCTCAGGCATCTAACGAGGGCTAGTGAATTCCTTCAGTGGAATTCTGTTTGGTGTAAGAAGCACGCACCTGGCGGCCACTATGT
TTTTAATGTACAGAGGCACGTCTTGTACAAGATGGTGCTCGTACGGGGGTCAGTGAGCTGCTCGAGAAACAGCTGAGAGCCTGTGCCCTCATCGGGTGGA
TAATATCC