Description :
From Genome Similarity Track
Location :
Scaffold_2044:4- 2082
Sequence
2078 bases(100 bases per row)
ACAAGTGCGTCACGCACCTGTTGAAGGTCGCAGGGGCGTTCTTCAGACCCTGCGGCATCACTAGCCACTCCCAGAGCATGCCGCTCGGCGTGCTCACAGC
CGTGAGAGGGATATCGCTCTCACGCATTAGGATCTGATAGAACCCATCGCGCAGATCAAGAGCACTGTAAATAGTGCTCCTGGTCATCGAATCGATGATG
ACATCTTTTCGCGGTATCGGTGTCTGCGCCGGTATCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATCCGCCAGCCGCCCTGTGGCTTCTTGATAC
AGAACGTCGGAGCACTGTGCGGGGATTTCGATTCCCGCACTTGTCCAGCTTTGCGACGACTCTCAAAGAAGTCGTCGATCGCCTTGACCTTCTCTCGCGG
CAGTGGCCACTGCCGCGTGACACAATACTTCGTCCCCGGCACGAGATCAATCTCGTGCTGGATGCCCTTGTCCTGCGGAAGTTCCGCACGGATCTCTTCC
GGAAGTACGTCCGCGTACTCCCGTAAGATTTCGTAGTAGGGACTCGTCTTCAACGAGTCCCAGCTCCGCTCTTCAAAGCGCTCCTTCTTCGTCTTCGCAC
TGAGAGTGTCCTCGCTCTCAGTGGTGCTCTCCATGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCATATTTG
CTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCATGACTGGAAGCGAAGTCAACTCCAACGCTTGCGTCGGAGGATTAGCGAGGGTC
GTCTCCCTGTACCGGAACCCGGCACAGGTACGCGTCAAGACGTTCAACGTCTCGACGTCCGGCTTTTCAGCCTCCGTCTGTCCGGCAGACATTTCTTGTA
GCGCCTCGGCCCCAGGCCGAGACTTGCGCAGCGACCTTCGCATGCGCCGTCTTCTTGCTTTGCGGAGCCCGGCTCCGCTTGGATCTTGACCTCGTCCAGG
CCCAGCCGTAGACGGGTGTTCTTCTTCAGTACCGCCGGCGGGTTCATCCCGCGGGCGAGCGACTTCAAGCCCGGCTTGATCGCCCGGCGCTTCGTCGTGC
AGCCCGGCTGCACGACAGCATGCAAGTTTTTCCGGTGCGGAACGTTTGCAACCGTCCGCACCGCCTGCAGCGTCGGCTCCCAGAGCCGACTCGCCATCTT
CACCTCGACGCCATCTTCACCTCGACGCCTGTTATTGGCGGAGCCCTCTATTACGGAGAGTGCGTCGGCTCCCTGAGCCGACGAATCGAATTCACCCAAG
CCATCGACTCCCTGAGTCGACGGCGTTTCGTCACCTTGGCTCTTATTATTGGCCAAAACTGATCCAATCAGATTCGCGTCAGCCTCCACGGCTGAGGCGT
GTGACTCGCCTGCGTCATCCGTGCCCCTTGTGGTCCGAGACTCTTCCTGATTCGCTGAAAAGCGGGTGTCGATCTCCGAGATCAACACATTTTCTCCTTC
AGCCGTCGGCGGCGACGCCGACGCTAGCTGCTCTTGCGCGCATGTTCGCGCGCGCCCAGGGCGCTCCGGGACAGCGGCATTTGGCGCTGTCTCGAGTGGG
GAGTCGCGCGCACCTGTCGGTGCGTACGTAGCGGCAACAGGGCCATCGCTCACTGTTCCGCTGTCGCGACCGAAGCGCACGAGAGTGCGCTTCTCCCAAT
CGATGATCGGATCATGCCGTGCAAGCCACGGCATGCCCAATACAATGTCAAAATTATCGTCCAGATCCAGGACGATAAAGGCCTCGACAAACTCTTGATC
TTCATACGTGAAGCGCACGCGTACCATGCGCTTCTCGGTCTTCACGACGGCACCCGTTGCCAGTCGTACTTCCAACATACTTCGAGGTATCTTTAAATCC
TCGAAGTCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTCTTCGACGCGCCAGAATCTACCAAAGCACGAAGAGAGCTGCTTGCTCTCATCGAGTTCA
CGTTCAGGATGACAAGGTCAGGCTTGTCATCTTGGTTCTTGCAGCGAGAATGAATCTCACTGGGGGCTGCAGTCCTCA