Description :
From Genome Similarity Track
Location :
Scaffold_339:4- 2080
Sequence
2076 bases(100 bases per row)
CGATCGACGTCGCTTCAAGCAGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATCTTCGATGGCGAGACAGGTT
TACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCGGAGATACTGAACCTCGAGGAAATGACGGCTGAGTCTTTCCTGGCCAACCT
CAAGGCTGGAGAGATTGCTGAGATGGTACTCATGAGACCTGAGACCACTCAGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGAAAGAC
ATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACA
AACACCCACCGACCCAACTCCCACAGGATCGAGGCGTACGGCACGAGATTGATCTCGTTCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCC
GCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAATCGAAATCCCCGCACTCGACGCCGACTTTCTGC
GTTCGTAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAGCAACGCAACGGTGCCGGCCCAAACACCGATCCCACGAAAGGATGTGT
TGTTGAACAACATGGCCGGGAGCGTACTGTACAGTTCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGTGACATCCCGCTCACTGC
GGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGAGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTC
CGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAATACGGCCATGGAGGTGCATCTAGGACACC
TCCGTCGAGTGTTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGT
CAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCAAACGCCCCGATCCCAGAAGGATCCTCGAAAGTGGTCTGGCTTG
GCCAACTACCTTCACAAGTACAGTGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGC
ATCAAGGCCAGTCTCCAAGAGACCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCTGTTTAGCATCGTCTGCGACGCCTCCAATTACGCCATCGGGTGTG
CATTGCTGCAGGCCGACACGGCTGGACATGAGCGCGTCATCTCATTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGGA
GCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTACGCCCTTTGTGATCTACACAGAACACGCGTCCTTGAGGACGGCG
ACTAACTCGCCTCACCTCTCCCAACGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATATAACTTCCGCGTCGAGTACAAGCCGGGCAAGGTCAACGTGC
TTGCGGACGCCCTCTCTAGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGA
TGAGGCTGTCGCGCCTATCGTCGAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAG
TTGAAGGAGGGCCTCCTCTATTATCGGGTAGAGCCCACTGATCCTCCACGGGTGGTTGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGG
CGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGAC