Description :
From Genome Similarity Track
Location :
Scaffold_1727:4- 1946
Sequence
1942 bases(100 bases per row)
GACGATGCGGAACTCCTTCGCCTTCAGGTCGCCCACGAGCGACTGCGCGCGGACTTGGCGGAAGAGAAGGCTCTTCGCGTGCAGCTTGCATCGACGCTGG
ACTCGGTCCAACGGTCGAATAACCAGCTCCGTTCGGAGCTGGACGCACTTGTTCGAGACTACAAGGTTCTGCTTGGGAACCTTGAGCGCGCTGGGATTCA
GATCCCTCGCAAGCGTCCGCGTACCGGTGGTATGGGCTGCGTGGAAGCTCCAGCGTGTACGCGTTGTCCGTGCGGCGCAACACGCGAAACGGACCAACGT
ACTTTGGTAGTAGCTTAGTACTACCAACAACAACGTTGGTGATTGCATGTGGCGGTAGGGTAGTCGTTGATAACAACACTAAGTCACCTACATTGAATGA
AAGTGTTTCCTCTTCCAGTTCTGTCCGCATTTTGCTTCTGTCGTTCGACCGCGTGGGCGATCGAGTTCTGCACAAAGCGGATGACCGCTTCGCGTGTCAG
CAGGAAGTCCCCTGCTGACTCGACTTGTCTGTCCGAGGTGCGTGTTTGTCGCACCGCGGAGACGTCCATGTCTTCGTCGACGAGAGTTTCGTCATTCTCG
TCGTCGACATCTGATGAGCGAGTGGCGTTCGGAGGCGTGCCCGAGCGAGTCCcTTCCCCCcTTAGAGAAAGTTAGAGAAAGGTCACTTTCCAAGAGACTG
GGAATACGTGGGTGGCGAAGACCATTCACGTAGAACGGCGCGTGCAGCGTTGACGTGTGCACAGAGTTGTTGATGGCGAATTCCACCATTGGCAGAAaCT
CGCTCCAACTCGAGAACGAGTGATCATATCCGCGGAGGATCTCCTCGATCACGCGGTTAGCACGTTCGGTCTGACCATCTGTCTCCGGATGGTCAGTGGT
CGACATCTTGACTTGTGTTCCGAGGAGGTGGAACACGGTGCGCCAAAACTCGGCGGTAAAACGCGGATCACGGTCAGACGCGAGTTCCCGTGGCAGGCCG
TGGAGATGGAAGACCGTGTCCACGAAGATGCGCGCACAGCCTTCGGCTGTGATCGACTCTGGGACTGCAGCAAGATGAACCATCTTGCTGAAGCGACCCA
CAAACACAAGAATGCCATCATTCTTGTTTGGATCTTCGGGAAATCCGAACATGAAGTCCATTGACACGGAATCCCAGCACTCTGTCGGGACCGGCAGAGA
TTGGAGCGGAGCGCGGAGTGAAGGACCTGGCTTCACCCGCTGGCACACCTCGCAAGCACGAACGTACTTGCGTACGAACTTATATTGGTGTGGCCAATAG
AAGTCGCGACTCAACGTGAGATATGTCTTCTCACGTCCACGATGACCGCTGACCGGCGCATCGTGGTATTCGTACATGATCCGCAGGCGCAGATCATGTG
TTGCTGGGATGATGACGCGCGACGTGTCGTCGGGCGTGGCGCTGTAATACAGCAGGCCATTTCGCAGAGCGTATCGATGAGCTGTCGATCGATACGTCGC
CGGCAAGGACTTCAGTGCTTGTTCTGATGGCTCAGACAACTAGGCCATCAACCGCACGATGTCTCCATCGTGCTGGTACGCAGCACGAATATCGTCGAGG
AGGCTAGACGACGGGCCGCTGGTGTTCAAAaCAACAGCGTTGAATGAACTCGTTGCCTCACTCGTCGGCTCCAAGTCAGGCCGACGAGATAGCGCGTCCG
CTACGACGTTGAGTCGCCCAGGCTTGTACTCAACGGTGAAATTaTACTCCGCAAAGAaCGAGAGCCATCTcGCCATTCTTTGTGAGAGGTGCGGACTGTT
GACAGCCGTGCGTAGGGACGCATGGTCTGTGAATaCCTTGAACGGTCTATCGCCTAATAGTTAGACGTGGAACTTGGCCAGTGCATACTTCATGGCAAGG
AGCTCCTTGTCATGCACTGGATAATTGCACTCAGCTGGTTGC