Description :
From Genome Similarity Track
Location :
Scaffold_1237:4- 1823
Sequence
1819 bases(100 bases per row)
GTAAGTACAGTGCATCGTACGCGTTGCGTACATATGTACTTGAGGCTCATGTGGCCCCGGTCGCATACGACACGCTCCTAAGCAAGTTCACTTTCAATTG
CACGGTGCAGGATCACCACACAATGGACTACTGTCAACAGTGTTGACCCGTCAAGTTGATGATGGCCAGTAGCCATCGACATCTTGTTGCAAATTTTCAA
GAACGCTCACGTGTAGACGAATGCGTTTTGCGATTGAACATCTTTGACAAAGATCGTCTGTAAATTCACCTGTCGTTGTCTGTACAGTGTAGTGGCACAC
ACGCGACTCGCATTCAGTGTCTGTTCTGAAGGCAACTGCATGAAGCTATCTGAATATACGGCTGAAATAGCGCCCACATCGTCCGCTGGTGTTCATGTTG
TCGGTGCAGATCTTGCTTAGCCCGGGGCCTATATGTGGTTTGCCTGTGACCTTCTTGACGCACATGGCGCAGAACAACCGCTTCTTGGCTCGGCCGGACT
TGCTGAGCTCGAAGACGTGGTGCTGCTCGAAACAGTCCTTGCACACGCTCTGCCCAATATCAAACAAATGTCAGTCTGCGACTTGAAATTACGACCTTCG
CAATGAATTTGTTCACAGATGCAGATGTAGCAGCGGGCGCACCTGGTGACAGCCTGAGCAAAGCGCGTGCGACCCGAGCTTCGGCTTTCGGCGGTAACAG
ACGTAGCAATTCGTGCTACGCACGGAAGACATCACGACGATCAACCGTTTGCTTTGCCTCGGGACCAGCAAAGTTGACGAGTGACGTTACCTGGAGGGCA
TCCAGTGGCGGCTATCGGCTTCGTCCATGAGTGCGCTGAATTTCTTGGCTAAGCCGACACGAAGACTATGGACGATGATGAGCCAGGTGCTGGCTACGCC
GAGCTGGATGGCCTTCTCCGGAGCTGAGTCAAAGTTGAGGATGGATCCCCACAGGAAAATCTCCGTCTTGTTGGTGCACTTGTGTTGTCGGTACAGATAG
CATGAAGCGGTACGCTGGCGTTGAATGCTGGGCATGAATCCTAACGACCACTCCGGTCGCTTGATGAACTGCGAGGTGTGGTAAGTGTGTTCGTGGCCCT
GCACGTCCGTGATAGTTACCACCCGCTCATACATAAGTACATCACGGTGGTGTAGCAACCCCCATGCGCACGTCCCGGCAAACCCCTTGATGCTGACGAA
GCGGAACAGATTTTCCGGTGCCTGTCCTACGTTAGTATTCAGGGAGGAGCGGTCCTTGACGTTGTAGAGTAAGCAGAGGTGATTTTCAGGTGTACATCGA
GCTCAAGTTGAAGCTATCGTCGGCGTGGGCTACACAAGCGATCTTGCAGCGGACGCGACGGACAGGTGTGTATCCAGCTGAGTGCGAGCGCCCGAAGAGC
AGCAACTCAAGCGTCGCTCAATCGAAAACTCTCGCGACCTCACGAACAAGCAGTGTCGAGCTCAAGTAGCGTCATGTAATGGGCCTACCTTGGCTCACTA
CTACGGCTTACACGTATGCGCACGTGTATGAGGAAGCGTAGGTTTCTTTTACTTGAGTTAAGTATACTCGAGATCCACGAGTATACTTTAAACAAGATAA
AGACTCCAAGTAGCGTGTTTTGGTAAATGTAATGGGCCTACTTTGGCTCACTACTTAGCTTACACGTGTGCGCGTGTATGTGAGGAAGCGTAGCTTAGTT
TAAATTAGAGTTAATTATACTCGGGCCTCCGAGTATAGATTAATCTAAATAAACGATCCAAATAATGTTTTGGGTTAAAATGAGAACTGCTATTTTTGTT
TTATGTTTCTGACTTCCTC