Description :
From Genome Similarity Track
Location :
Scaffold_469:4- 1780
Transcript NameFunction/comments
g15757.t1XP_009530061.1 hypothetical protein PHYSODRAFT_334506 [Phytophthora sojae

Sequence
1776 bases(100 bases per row)
TTGAACACGTTTAGACGCAGCTTCTTCGTCCGCAACCCCTCGTGGACTTCGCACCTTCCGGAAACCGGCAGCTTTCAAATGCCACACATACTCCGACCCC
AACAGATTAATCTCGTGATCCGTTACTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAAT
TTACTTAAGTTCTGTATACTTGTATCCAGAAGTATACTTAAACCTAGATAAAAGAACCAAACGGAAGCTTTGGTGGTAAATGAGAACTGTATTGATTGTA
AATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATCGGCTGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAG
GTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGATCACCTGAATGTGTGCCTTAGTGCATGTTGCACTAAGGTAGG
AGGTGAACCGAATGTGTAGCCCCGCTACACCATCCCCCCGTTAGGATTTGACGTGCCGGTCTCGACACGTCAATCCGTATTTTCTTCGGGAGAACACGTG
CTCATTCCAAATGAGCACGCCAACGACGTCTTCGTCCAAGACGCCGGCCGCTTCGGCAACAGCAAGTGCTGTCGTCGCCTCCAAGGCGACGAAGGCCGCT
GCCTCAGCCACGACCGCTACTGGCATCGCCTCGACGGCGATGCCGACAAGCGCGGCAACAGAGAGTCGCCTCTCTGTTGCTGGATACCACTCGAGATGGC
ATGAGAAACATGTCATCCGAAACAAGACAGGCAAGATCATTGCTGTCGAAACCGGAGTGGGTATCTACTCTCCGGGTGGAGAGGGAGTTCCCCTCGACTA
CGGAAGTGAAGTCGAGGAGGGGGAACTCGAAGGAGACAAGGACATCTTGTCTCCGGGCCACACTGACCCCAATGTGGGTCTGCGTCGTCCACGCGAGGAC
GACCCGAACGCTTCGAGCTCGAAGCGTTCGCGCAGCGGCAGTGGAACACCGCTCGCTGTCGCTGGAGCCTTAACGACTCCGCGGGATGGAGATGACTCTG
CTCCATCCGCTGTTGTTGCGGCCTCGCGCACTGAGCCAGTGCGCGAGCCGTGGATGCCGTCTCAGTCTGAGATCGGCAGCCGATTCGGTGCGACCGCGCC
ACCGAATCTGTACGCGCTGTATTCGTGCAACGCCATCGTTGACGATGACGTCGCGAAGCGAGTACACTTTGATCCGTTAACGAATCAAAGGCGCGACTAC
TACATCGGGCTTCTCCATGAGCTCCGATGGTTTGCGAGCAAGAAGACTTCTCGCAGAAGCAAAGTGCCCGAGTGGCAGGCACTTTGTCAAAGTTGGAGTG
CCTTTGTTGAAAACTTCAACAAGAACCCCGCTGGCTATCGCGACCGGATTAGCCAGGCGCGGGAGCGCTACGAGAAGTTCTCGAAGCGTGGTAAAATTGA
ACGACTGCACCATGGTGCAGTCGGTATTGGACTTCCTTGCGCAGTGCCTTATGACACTGCTTGTGAGTACTGCTACCCTGGAGCAGTACGCATCACCGAG
CGGGACGTCAACCGGTACACGTCCATGTGTGTACCTGACGACCTCAAGACCCTGCGCGCCAGTTTTCAGGCGCAGACGTCTTCTAGTGCTGCGGATATTC
GCAGCACTTATTCGAATGCTGTAGGCGACTACAGCGCTCGCCCAAGTTTTACGCCCTTCGGCGGAGGTGGCGGTGG