Description :
From Genome Similarity Track
Location :
Scaffold_3427:4- 1709
Transcript NameFunction/comments
Phypl_g15827pol protein

Sequence
1705 bases(100 bases per row)
ATGCGCCAGCCAGTGGCCACTTGGGCCGAGAGAAGACCTTCCATTCGGTCTCTCAGTTGTTCTGGTGGAACCACATGTACAAATGGGTTGCAACCTACGT
TAAGACATGTGAAACATGTCAGCGTATCAAGCCTGCGGGCCACGCATTGGCTCCTTTGCAGACCCTGCCAGTGTCACTGGAGTGCTGGAGGTCGATGAGC
CTCGACTTGCCCTTGGCTTTCCAGTCGATGACCGCGACAACACCGATATTTTGGTGTTTGCGTGCCGTCTGAGCAAGACGGTGCACCTTGCTCCGGTTCC
CGACACTGTCACCGGGGAACAAGCCGCGAGGCTGTTCCTGGATTGCGTGTTCCTCTATCATAGTCTTTCGGAGACCATTGTCTCTGATCAAGACCCGCGG
TTTACCGCTGTGTTTTGGAAAACGCTGTTCCAGCTACTGGGAACGAAGTTGCTTATGTCAACTGCTGACCATCTTCAGACGGACGGTCGGACGGAGCGCG
TTAACCTCGCCCTTGAAGACACGCTGCGCAGTGTCTGTGCCGAGGTGCCAAGCACGTGGGCAGCACGGCTGCCCACGGTTGAGTTTGCGCTCAACAACGC
GGTGCACGCGTCAACTGGATTCACTCCGTTCTACTTGAATGGGATGCGTCATCCCCAGGTGCCGCTCACTTTACGTGGGGCCACCGATGCTTCGGTCGTA
AGTGGGGGAGAGGCTAGGGAAGATCTATCCTCCCCAGTCCCTGAGGTGAGACCAGCCGCACTGCGCAAGCAATTGACGTCGTTTGTCAACGACAGGTTGA
ATGTCATCAGCTGGGTTAGAGACGCAATGGCGTCAGCCCAGGACAGGCAAAAGGAGTACTCTGACCGAAGTGGAAGAGGAAACTTAAACGTGTTTAATGT
GGAAGACTTAGTACTCCTAGACACGAGGAACCTACCCATGAACACTGTAAGTGCTGGCGGCAGTaacaagctgaagcacaggTTCATTGGACCCTTCGCG
GTCCTGAGTATGCACGGAGCTGTCTACACCATCGACTTGCCTAAGTCGATGGCGGCCCACCCGACATTTTATGTGAGTCGTCTGAAGCGGTACCACGACC
CGCAGGAAGTGGCGGGTAGCCACCAGgctcggccacctcctcgaAGCGAGACTAAGTCTCAGGCACATGTGGCCCCTGATAAGCGATCGGATAGTCCCAC
GGACCGTAAGGCCGTGGCGCATACGCTGGAGCCGCGTGTGCCGAGTCGCCGTGCGAGCCATATTGGTACGGCTGGGAGTACGCGTACGGCTGAGCCTCCC
GGTAAGGTGCTCGGCCACAGACCTGGGGCTGGAAGTCATGTATTTGACGCCGCAGGTCCTCGACCTCAGAGGTCAGAGCACGTCATCGACCCGCTCAAGG
CGATCATGATTCTCCCGCTCAAGTGTCTGGGTGTGGCGGTGTAAGCCCTCCAGAGCACCGAGTTTGCCGGAGTGGGCAGCAGCCTGGCCAGACCAAGCGC
GATCTCGAGAGCATACACTCGATCGCGGAGGAGACGAATATCCTCTTGTTGCAGCGCAACAACCTGGTCTGTCGGCcccgcagccgcagcccTCGGAGCC
TCCCTCCTCACAGGAGACTAGTACTCATAGTCGAGCGAGGCCTCCACCGACCCTCCTCGACCGTGGTGGTGAGCTGCATTACCACGTGGAGCAGGTGCTC
CTGTA