Description :
From Genome Similarity Track
Location :
Scaffold_3516:4- 1669
Transcript NameFunction/comments
Phyta_totarag15334hypothetical protein

Sequence
1665 bases(100 bases per row)
TTCCGACATtttccgacaaatatttgtcggaatCCTGAAGGAAATATGAATATGACAATACAAACAGCAAGTAATTAAACTATTGTTGGTAGATTTTGGC
GATTCCGCGTTTTAGGCATTATCCTAGAGTAGACTGCATTATCCTAGGACTGAATGGCTTGGTGGCTAGGATAGTTCGTCATTGTTGAAAGCAGACGAGT
CATGAGCCTTGCGTCGTTCGTGCCGACGAACACGCAGAAAGTCCGCACTACCGCGGTAAGCGCTTTCAAGCgcatgctggaagaggagcgTGTGAGCATT
GATTATGTGCAAGCTAGTATTCAAGCTGACACAACCGGCAAGCGATTGACCACGACAATGGACCGGTTTGGGTTTTATCTGGCCACTAATGAAGGTAAGA
AAGGTAAGCTTGCGCGCAACACAGCCGTTTCGTATTATAGAAATGTTAAACTTTGGTTGTTTGATGTGTATCCCCACTTACGGGTGCCTACTGAGTTACT
GCTTCTAAAGCAAGTAAAACTCTAGATAAACATTGTCTGAAAGAGAAAGGGGGGGAGGGGCTTGTTAATAAGGCGCCTCCGTATACGAAGGAGGACTTAC
GTTCACTAACCGAGTATGTGTATAGCAACGCTCGCGTGAATGCCGACTACCAGAACGCGGCGCTTGCGTGTCTGATGTGGCACTGTTTCGGACGCTCGTC
GGACCTGGGGTACATCCAGAAACAGCACGTGTCAGTGTCAGCTGACAGCGTCTTCTACCTGCGCCTGCTGTGCGTGAAGACCGCCGAAGAGCAAGGGTTC
ACCCTCGTCCCTGACAAGAACGACTTCCTTACCTGTCCGCTCCACGCGTTGGCTGTGGCGTTGGTCACGCAGGACGCTTCATGTGGCTCCCTGCTGAGCC
AGCTCCCTGAGCTTGTGCCCGCCGAAGCTAGTGACCTTGATCCGGGTGCATCGCTAtttgagttgctggaggcAGAACCAGCCTCGTTGAACGTTGCCCT
GGCAACGCCAAGCTCGTACGCGACCGCCGACCCCATATTCTTCCGCCGTAAGTGCTGTCGCAACTCCCCTTGCCGACGACCCAAGCTCGGCGCCATCGGC
TTCTACGCGCCAACCTCGTCGATCGACGGAGTCTGCGCGAGGCGGTGATGGAGTCCAGGCAAACGTAAACCGCCTCCTGAAGCGCGTAGCGGATCCAGCG
GGCACGACCGGAGACCTGACGTCGCACTCCTTTCGACGAGGAGGCGCTCAACATGCAACGGggacgagaaggtgacgGCGCAGTGAATCTTCGACAGGGG
TGCCTGGGACATGGGCAAGGTTAACAAGGCCTTTGCTTACGTGTTCAATACGCCGCAAGAGGGCCGCAAGGTAGCGCGCGTGCTGAGTGGATGGGACGTT
GATGACAAGCCTGTGGTGGCGTACGTATCCGACCTTGACCATGCGACGCAGGAGCAACTCGctcgcctccagcagcagctgtacAGTTCATGCACAGGGC
TAAAGGAACACAGGTTCAACGTCAGTCGCAAAGTCCTCTCAGTACTCACCACTTACCTGACCAAGTACTTCCCGCAGTTGAAAGCGCTGTCGCCCTGTGC
CCCGATCGTAACGCGCGTCGAAGAGTGCTTGGACGCTGCAGGAGTCGCTCGTACCGACATGCTGG