Description :
From Genome Similarity Track
Location :
Scaffold_308:4- 1643
Sequence
1639 bases(100 bases per row)
TCGAAAAGAATTGCGAGGTGGCTGTCCTTCTTTGCGGAGTAAAAATTCTCCGTGGAGTACAAACCCGGACGATTCAATGTCGTCGCGGACGCGTTGTCAC
GCCGACCCGATTTCGAGTCGGCAGTCCAACAGTGAGGTCGATGCCATTGTTGCAACACTAGTCACTATTGTTCCGTCGTCAACATTGCTTGACGACATCA
AAAAGGCCTACGCAGAAGATGAGGCTCTTCTGCGACTAATGGATCATCTGGTGACTCCATCGTAAAGCTCTCAAAGATTTACCGACCTTGTATCGATCTT
CCGCGGATAGATACATAACACGCAACGGGTTGCTGTATTATACAGCCGTTGCCGGTGACACACCTTGTGTCGTCGTCCCTACTCATAATGATTTGCTCTT
GCGCATCTTGTATGAGTGCCATGATGCACCACCTAGTTGACATTGTGGGCATGAGAATACTTATCTCACGGTAAGTCGCGACTTTTACTGGTCGCGCCAG
TATCAGTTCGTGCGCAAGTACATTCGTGCTTGTGAAGTGTGCTAACGGGTGAAGCCCAGTCCTTCATCTCGTGCGCCACTACAGCCTCTACCAATCCCAG
CAAAGTGCTGGCAGTCCGTCTCAATAAACTTTGTCTTCGATTTCCCCGAAGCCGATCACAAGAATTTTGGTATTCTTGTGTTCGAAGACCGATTCAGCAA
GATGGTACATCTTGCTGCAGTTAATGAGTCAATCTCAGCACATGGTGTGTGCCCGTGTCTTCATTGGCACGGTATTCCGAATCCACGGTGTACCCCGTGA
ACTAGCCTCTGATAGAGATCCTTGGTTCACGGCAGCGTTTTGGCAATCCGTGTTCCAATCGCTCGGAACATGTCTGACTATGTCTACTTCTGGCCATCCC
GAGATTGATGGTCAGACAGAACGCGTCAACTGCGTCCTCGAAGAGATACTTCGAGGATACATCTAATCTTTTACAGATTGGAGCGAATTCTTGCCGATGG
TGGAGTTTGCAATCAACAACTCCGTGCATGCATCGACAACGCGTACATCATTTTTCGTTAACGGCTTACGCCATCTTCGACTAACCACCCATTTAGAGTG
TGACACTAATTCAAGGGGGGAAGGATTCGCTCGAGCAAAAACCGTTCTGGCTCTTGCTCATCACGTGTCGAGGTAATCGACGACGCGAAAGTTGCCGATG
TCGATCAAATCGTCATCGAAGCTGATGATCTCAGCAATAGTGACGACACTATTGCTGACCCAGATGAGGATGACGAGGAGGTCATCCTCTTTTTCAGCGA
GAGTGTTCTCATCCTCGCTGGTGAGAAGCAATGGTCCGTTTCGTGCAAGACTCCATCGCTAACGCGGTGGACCGGCAGAAACGGAACACTGACAAACATG
GAAGAGCAAACGTTCTTCTATTTAATGTCGAAGACTTAGTTCTACTGTCTACTATAAATCTACCTAAGCATGTAGTAACTAATGTGGGTAGTAGTAAACT
AAATCGGCTCGTTCCGTGTACTACATCGCAAAAGCAATGCGTACACGATCGAGTTGCCACGCAGGATGTGTACGCATCCTACGTTTTATGTCGGTCGTCT
CCGCCCGTACCATCATCACGAAGTCTCTTCCTTAGGCGA