Description :
From Genome Similarity Track
Location :
Scaffold_2843:4- 1612
Sequence
1608 bases(100 bases per row)
AACTTTCCAGTTTACTGCAAAAGAGCTTCTGGAATGAAGTAGGGTCTAGGCAATTTCAGGGGACACCTTGTTGGGTCTTAGGCATGTTGTGATATGACTG
GTCCTGGGGTCGTTACGCACTGCGCCAATCGCCCTCATCTCTCTCAGAGAATGGCAAGATGGCTTTTCCTTCTTTGCCGAGTATAACTTCGAGGTGAAGT
ACAAGCCGGGGCGGCTTAGTGTAGTGGCCCGATGGGCTCTCGCGCAGGCCGGACTACGAGTTAGCTCATGTCACGACAGTGACGTCGTCAGTGCCTGACT
TGATACGCGGAGCGTATGCACAAGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGAGTTTAAAGACTCTGACAAGGAATTGTCTGGGCG
CTTACGCGCGAGGCTGCATCGATACTCACTCGATGGCGGCCTGCTGTACTACAGCACCGACTCTGAGGATAACCCTCGTGTAGTCGTTCCTCATGATGAG
GATCTAAAGTATCGAATCCTCTACGAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGTCGGGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGT
GGCCCAAGATGTATAAGTGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGACAAAGTCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTT
GCCTGTCCCCAAGGGATGCTGGCAGTCCATGAGTATGGACTTCGTGTTTGGCCTTCCCAAGGATAAGGCGGGAAACACGGGTATAGTGGTCTTTGTAGAC
CGATTGAGCAAGATGGCTCATTTAGCGGCAGTGCCGGACACCTTTGATGGTGAAGGTACAGCTTTGCTGTTTTTAGACCGAGTTTTTCGCCAACATGGCT
TGCCTGAGGCAATTGTCTCGGATCGAGACCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCTTCAGAGTGCTCGGCACTCGTTTGGACATGTCCACAGC
GGACCATCCGCAGACCGATGGTCAAACCGAACGTGTGAATCGCGTTGTGGAGGATATCCTCCGAAGCGTATGCGCTGAGGCGCCAAAACGCTGGAGCCAG
ATGCTCCCACTCGTTGAGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGGCTACACTCCGTTCTATGTGAGCGGCTTGGCTGACCCTCGCGTCCCAC
TGACGCCGCCACGCAGTGGCTTAGGGCTTGATGGGGGAGGGATAGCCGAGCGGCTAGCTGATGTCAGCCCTGTTGCGGCTCGCAAGCAAGTCAATGACTT
TGTCTCTTTGAACTGAGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGACACGCAGAAGGAACATGCAGATGCCAAGGGCAGAAGCAATG
TTGAGAGGTTTGAGGTCGGTGACCAAGTTTTATTAAACGCTAAAAACCTACGTACTCATGCAGTGTCTGCAGTCTTCAAGATTAAGTTAAGACCTCGGTT
CATAGGACCGTTCAAGGTCGTGGCCAGGAAGGGCCTAGCGTATACGCTCAATCTTCCGAAGAAGATGCGCACGCATCCGGTCTTGTATGTTGGCTTGCTT
AAGCCATA