Description :
From Genome Similarity Track
Location :
Scaffold_831:4- 1588
Transcript NameFunction/comments
Phyra_86562reverse transcriptase

Sequence
1584 bases(100 bases per row)
GAGATGGTCCTGATCCGTCGCGAACTCGATTCGATCGAGCTCAACACCTCCTCGGCCATGGACCCCGAGGTGTTGGAGGACGAGAGGTCCTCCTCGCGGC
AGAAACGATGTGGCGCGGCCATTTTGAAAGACCCGTCGGATCCGTACTACCCCCTTTTGAAGGAGTTCTCGGATGTCGTCAGCGATAACCCACCATCGGT
GTTACCTCCAGACCGAGGTGTCCGACACGAAATCGATTTGGTGCCGGGCACCAAATATTGCACCACGCGCCAATGGCCACTACCGAAGGAGCAAGTCGAT
GTGGTCGACGCATTCTTCGCGGAGAAATATGCCTGCGCAAGTCAAAGTCGCCGCACTCGCCCCCGACGTTTTGCGTGCGTAAACCCAATGGAAAGTGGCG
CATGGTCCATGCGTTCAACAAGTTGACTGCAGCAACCATCCCGGCGTCCACGCCAATCCCTCGCAAGGACGTGTTACAGAACAACATGGCGGGCTGCACC
ATCTTCAGTGCGCTCGACATGGGCGATGGCTACTATCAGCTGCTGATGCGGGAATCAGACGTCCCGCTCACAGCGGTGAGCACACCCAGCGGGATGCTGT
GGGAATGGCTCGTGATGCCCCAGGGACTGTCGAACGCACCAGTCACGTTTAATCGACTGGTGACTCAACTCTTCCGGCCGATGCGGCAATTCGTACAGAC
GTACTTTGATGATATCTTCGTGCACAGTCGTGCCTCAGGAGGTAAGACGGCTGTCGAAGTGCACGTTAACCACCTCCGCGAGGTATTGATGTGCATGCGC
GATAATCGCTTGTATGCGAACATCAACAAGTGTATCTTCGGAGCTGAAGAGATTCCCTTCTTGGGATGTGGCCTTGGCAAAGATGGTGTCCGTGCGGACC
CCGAGAAGATATGCGCGATCGCGCAATGACCAGTGCCAGTATCTCAGAAGGACTTGCGCAAGTGGCTTGGCCTTGCCAACTACTTACACAAGTACAGCGC
CAACTACGCTGAGATGGCACGGCCGCTGACGAACCTCTTGAAGAAGGAGGTGGAATGGTTGTGGGACGATGAAGCTCAGCAGGCTTTCGAGGCAATCAAA
AGCAGCCTGCAGAGTGCTCCGATTTTGGCTTTGCCCGACGATGATCGTTCCTTCAGTGTGGTATGCGACGCATCCGACTTCGCCATAGGCTGTGCCCTGC
TGCAGGTCGATGCCGAAGGCAGAGAACGGGTAGTATATGTCCAGTCGCGCCAACTCAAGGCGGCTGAAAAGAACTACCCTGTCCATGACAACGAGCTTCT
GGCGATGAAGTTCGCGCTCGTAACGTTTCGGGTACACCTGCTTGGCAGCAAACCCTTTGTGATCTACACAGATCATGCGTCCTGGCGGACAGCGACGTCG
TCGCCCCACCTCTCCCAGCTTATGGCGAGGTGGCTCTCCTTCTTTGTGGAATATAACTTCACGGTGGAGTACAAACCAATGAAGCAAAACGTCTTCGCGG
ACGCGTTGTCCCGGCGTCCGGACTATGAGCTGGCGCACGTTGCGTATCTCGAGTCCCACTCTATGAGCTGCTACGCGAGGCGTA