Description :
From Genome Similarity Track
Location :
Scaffold_411:4- 1556
Sequence
1552 bases(100 bases per row)
ATATTCCTTTACTGCAGTGATCTCCCCAAGAAATATGCTTTGAGAGTAGTTAGTAATGCTACAAGGGCTGAGTAATGCCCTGCCACATTCAACAGATGTA
GGACAAATATATTGAGATCTGTACGAAATTTCGAGCCCAGCTACTTCGATGATGTGTTCGTCCATATCAGCAATATGGATGAACAGACGGATGTGGAAGT
ACATCGACTCCACGTCCGGAAGGTTCTAATCCTTATGCACGAGCGTAAGTTGTACGCCAACCTCAAGAAATTCATATTTGCTGCTAGCGAAATACTACTT
TTTGGTTGCATCGTGGGTAAGCATGGCGTCCGGCTCAATCCGGAAAAGATCAAGGAGATCACTGACTGGCCGGTGTCTACCGACATAAAAGGACTCCGAA
AGTTCTTTGGCCTAGCGGCGTATTTGCACAAATACTCGCACAATTACGGCGAGATGGCTGTTCATCTCTCTCGTATATTGAAAAAGAACGAGAAGTGGAC
ATGGAGTGCTGATTGCCAGCGCTCCTTCGAAGGTATTAAGCAAAGTTTGATACGCTCGCCAGTTTTGGCATATACAGACCAAGACAGACCATTTCATGTC
GTCTGCGATGCAAGTGATTTTGCCATCGGATGTGCACTAATGCAGAGCGTGTCGTCTTCTATCAGTCATGTCAGCTGCAACCGGCTGAACGTAACTATCC
AGTCCACGACAAGAAACTCCTTGCCATCAAGTACGCTTTGGCGGAATTCAGAGTCTACCTGCTAGGTGATAGACCCTTCATCGTTTACACGGACCATGCG
TCCTTACGCACGGCCGTAAACAGTCCACACCTCTCGCAGAGAATGGCGAGGTGGCTGTCATTCTTCGCGGAGTATAACTTCTCCGTGGAATATAAGCCAG
GACAACTGAATGTCGTCGCTGATGCTTTGTCGCGCCGGCCCGATTTCGAACCGGCTGCGCAACCCGACACTGGTCCGACCACTGTCGCGGTGTTGACGTC
GAGTGTCCCGTCGTCAACCTTATTCGAAGACATACGCAAGGCGTACGATCCGGCGATGATGCGTTCGATGAAATATCTCTCGCAACCATCCCGTCAATCT
CTTCAAAGGTTAACCCCAGTATATCGATCCTCCAAGGATAGATATACAGCCCACAATGGCTTACTGAAGTATACAGCCGTTGCCGGCGACACGTCTCGTG
TCGTCGTACCGGACCATGGTGACCTGCGACTGCGCATCATGTATGAGTGCCACGACGCACCTACTGGTGGACATCGTGATCGAGAGAAGACATATCTCAC
AGTTAGTCGCGACTTTACTGGCCCCGCCAGTATCAGTTCGTGCGTAAGTACATCCGCGCATGCGAAGTATGTCAACGAGTGAAGTCTGGTCCTTTACTTC
GTGCGCCGTTGCAACCCTTGCCCATTCCGGCGGAATGCTGGGAATCAGTCTCAATGGAATTTGTCTTTAATTCCCCGCAGACCCACACCAGAATACAGGT
ATTCTTGTGTTCGTGATAGATTCAGTAAAATGGTACACTTGGTCGCTGAACC