Description :
From Genome Similarity Track
Location :
Scaffold_818:4- 1547
Sequence
1543 bases(100 bases per row)
GGCGTCCGCTGTCCGAGGGAATATCCACTCAGCCCGAAGAGGCAACTCATGGAGATGATCGCAACTCGGTTCAATTTCTTGGCTGACCAAGGCTCGATGT
CTCTGGCAGCGAAGGCCACCGGAGCACGTCTACCAGGAATGAAAGCAGCATCCGGACCGAACGGAGCCGCGGGGAGCATCCCTGGCAGTGACGAGTTAGG
GGGGGCGGGGATCAAGACAGATCCAGGGGATCCGCCACCGTGAGGCGATCCCGGGGATCCGCCACCACGAGGCGATCCTGGGGAACCGCCACCATGGGGC
GATCCTGGAGATCCACCACCATGAGGCGACCCCCCTCCACCAGATCCGGAAGATCCGCCACCAGGCGCACCCCCTCCGCCAGATCCAAGGAGTCCGCCAC
CACGAGGCGACCCCCTCCCACCATCACTGCCCGATCCACCGTCACTGTCGACGTGGATCGCAGATCCCGCAGTGGCGCCTCCGGATCCGGCTGTGCCAGC
GACTTGTGGAGGCGGCGTCGAGAGGGATCTCCGCCGGGTTTCGGATCGGGATTGGGATAGAGCCCGCCGCGTGTCTTCCTCCAAGGCATCCTCAGCGGCT
TGAGCCTCCTCTGAATCCTCTGGACTCTCGTCGTCATCGTCGTCGTCATCGTCCTCATCGCTTAGAGTAAAGGGATACGGGCCGGCAGACGGCGTACGCT
TTGACGACGATCGGTTAGGAGGCCCTGAGCCGTCGGACCAGTCAGAGTCCTCATCCTCATCGTCCTCCGAGCTACCCAGTCCACACCCAGGGGGAATGAC
GCGTTTAGCTTTCCCCTTCCCGGGTCCAGTACGGGCCGGCGGAGGGTTGGTGGAAGCAGACTGAGGAACGATGGGCGTCGTTACCGAAGGACCAGCGGTG
GATCCCGTCGTGGACGCCGATCCCGATTTTGATACTGCCGTAGATCCCGTTTTGGCCGTCGATCCGGACTTGGACACCGCTGATCCTGTTTTGGATGGGG
CAATGGATCCAGACTTGGATCCGGCACCTGACTTCGAGGGAGAAACAGAAGTCTTGGGCGCGGGTGTAGATCCTGCCTTGGACAAAGAAGTGGATCCCGC
TTGCGGAGCAGATTTAGAAACCGGAGTCGTTTTGGGCTTGGCTTTCGGGGAAGCTCGGGCCTGCTTATGGGGACGGGAGGATCCGGTGCTAGGAGCGGGA
GATGTACTACGCGGGCGTTTCGCAGTCGACGAATCCGCCCCACTTACCGTCGGAAGAGGAGCAGAAACGCTAGCAGCCTGAGAGGGCCCCGACAAGGGAG
GAAGTGGATCCGAGACGGCAGCTGTCACCAGCGCCAGTCGTCGACGTGCCAAATCGCGCTCCGACAAGCCGCGATCGCGCTCCAGGATCAGCTGTTGCTG
CTGAGTTTGGGCTGCGGAAAGTTGATCCTGGAGTTTCGCGGTGGTCGCATCTGCTTTCTTCAATTTGTCACCTAGATTGACAATAACAAGTGAATATGGA
GTTACTAGCAAGGGCTAAAAGAGGATCCACGTACTCATGCGGC