Description :
From Genome Similarity Track
Location :
Scaffold_4106:4- 1524
Sequence
1520 bases(100 bases per row)
ATCTCTAGACACTGTTAGCTCTGTCGGCAGCAACAAACTGATTGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCAT
CGACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGTTGCTGACTCGCAGTCCCCCCTTG
ACCCAGGTCCTCGAAGCGAGGGCCAGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCATACCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCG
TACGCCGGAGGGGCTCCATACGAACGGATCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCC
GCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATTCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGT
GCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAAGATGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCAGCAGCATTACCGCCAGTCCC
AAGGCCAAGTGCAATCTCAAGCACGAAGACACGTTGACGGAGGCGGTCAACCTCAGGGTCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGG
CTCTCGGGATGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCGCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAG
GAGCAACGGTGTCGCGGCAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAGCGGCTCCTGATTGACA
GCTCGAAGGCTGTCGCAATCTGGAAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGACGATGAATACATACCG
TACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCAC
GCTAGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCGTAACTCCGTGAGTGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTC
ACAAGGACTCCACGTGGGACAGTTCTCGGGCATAACTCGAGAACTGTCCCACGTGGAGTCCTTGTGGTCTCGGGCTTCTTATGACAAGTAGTGAAGTCCT
TAAAGGGAATGCGGTCTTGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGATGAGCAACTGTTCTTTCTGAACAAGTGCTCGTTCATAGATGCC
CCTAGAAGTGTAGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAG
TTGATGGCAGCTCCCTGGCT