Description :
From Genome Similarity Track
Location :
Scaffold_151:4- 1439
Transcript NameFunction/comments
Hyaar_Emoy2811231conserved unknown protein
Hyaar_Emoy2811232hypothetical protein

Sequence
1435 bases(100 bases per row)
GATCAACCATGATCCGATTGTTGGCGAGGAAATTTACGCGGCTACAAGCAAACAGAACATTGAAGCGTTTCAAACAGCAGCAGTCGGTTGTTTATTATCA
ATCCCCTCCATGACTTCCACTGCAGACTCCTCCATGCAATCACTTTGCTTGATTGCTGCTGCCATCCCGCTGAGTTTGCGGGTTATGCTCAATGAGGTAG
GACGCTAGCCACTCGATCGGGTTCGACGGACGCTCCTTCACAAGCGCCGACATGCCCTGCAGTAGAATCGGCACGACCGTCTGGTCCAAATACGCGCGTA
TGGGCAGCGCTTGCACCTCTGCCTTGTTCTGGGCACTCTCCACTGCAGTCTCCCCTCCAGATTTGGTGGTCTCCTGCTCGTCCTCATCCTCTTTAGCCTC
TAAGCCTTCAGGTCCAGATTTGTCAGGAGTCTCCTTCGTATCGCGATTTGCCTTGTGTGCTTCCTCGACATTTACTTTTTTGCCCTCACTTGTCTCGATA
TTCTCTTCAGTTGGGGTGATAGATTCCTGCATTTCTTCGGTTTGAGTAGGAGGAATCTGCTCGTGATCAGCTGGAGATACGTGCATGACGTTAGACTCGG
AGGTGGCATCTATGCGTTTGAAACAAAACAAAAACACATAATTAACAAGATTGTTTTTTTCAGTTTTTTAGTTCAATTTGTAGCAAATATAATATATCGT
GGGCGTGAAGTTACGAGGTAGTACGTACTTGGGTGTTGAGCCTCGGTTTCCATTATGGATCGAGAAGGTTACGAATAGAGTGAGAGAGAGAGAGGGACGT
CGAGGAACGTCGGCAGTCGCTTGGTTGTAAATTGCTGATACAGATGAGGATAGGAGTGACTGAATAAAAAACACAGTGTTGGTCACGGTTTGGGGGGAGT
AGAGAGGTAAAAGACACATCATGATGTGGCCAACACCGTCTCAAACAAATGTGGCTGCTGCTGTTTGATACAGTCGCCTCTAGAAATTCCAGATTTGAAA
AAAACGAGCGATCGAAACAAACTTCAGCAAAAGTGGATGAATGTCTGCGCACTCAATCAATTGTGCAGTGACCACCTTGCAAGCACTCCGGATTCATCTT
TACCTATAAAGCCATCACCATTACCTAGAAATAACAAGAAGCTGCAGTTGCAGACAATCAATCCTGCTCCACTGAGGTCTCTGTTGCTCACCAGTACTTC
TGGTTCCCTCCTCAGGTCTCTCTTTCTCTCTCTCTACATGTTCCGAAGCGCCTCTTCTTCTTCGTGCTCGAGTCGCATGGCCTCTTTGATCGCCCGACTT
TCTGCTTCGACCCAGCCCTTTTCAATATCGTCGTACTCTGCAGGGTCTGCAAACTCAATGCCGCGCATCTTGGAAAACTTGTCGAGGAATCGGTGACTCT
CCACTTGGTCGTACTTCTCAATGAGCATATTGAAC