Description :
From Genome Similarity Track
Location :
Scaffold_4209:4- 1381
Sequence
1377 bases(100 bases per row)
CGACGACATTCTAATCCCGGCAGAATCGTGGGATCACGTTGTGTGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATATCTCTATCAGCGT
GGTAAAGAGCTATTGGGGAATGCGCTAGGTGGATTACTTAGGCCATCGAGTCTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTTAGCAGACTTG
TCCTTCCCACAGTCGTTACGGGCGATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCGGATCCAGCTTACCAACTGCACCCAGACACCGACTA
ACGGAGGGGGTCTTTGCTGCGATGACCAATCCATCCGTCTGGGCCGAATAATAAATCCAAAGGGTTCTGGCCCTGGAAAAGGTCCGAATCTCCGAAGGGG
ATCTCCAGTTAGTAACACGCCCCGAAGAAGATCTAAAAACAGGAGCTGGATTCACCCGGGACCCACGCGAGAGAGGATCCAGTCTGGATAGAAACGACGA
TCGGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGGATCGCGACCACGCCTATCCTCCGTCATTTC
GATCCAGAACGTCAACCTACGGTGATAGTTTATGCCAGTGACTGGGCAATCTCAGCAGCTCTGGTACAAGAACATGAGGGAATCTGTCATCCAGTCACCT
TCGTCAGCCGGACATTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTGAATTACAACCTGCT
AGTGGGAAGATCCATCCGGATCCTGACTCGACACTCTACGCTAGCCTGGCTGTTCAAGTCAGCCGGGTTGCAAGGACGGTTGGGACAGTGGGCAGCTTTA
CTCTCGCCTTGGACACTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATGGATG
AGGCGCTGACTAGGATCGCTCCTAAGAAAGAGCCCAAGCGCCAGATTCAGATCCCGATTCCGACGGTACAGGTGGATGAGGATCTGTACGTCCTGAGTTT
CGATGGATCCGCTCGCGTACGACGCGGAGGCGGGGCGTACAGTGCAATACTGTGGAGACTACTCTGGGATGGGAAGTTGTACGGGCTAGAGCTACTTATG
CGGAGGCCTCACCGTCAACGAAGCGGAGTATAACGGGCTGGGTTCGGATCTACTAAAGGGACAAGATCCGAAAAGGCTGGTGATTTTGCGGGGATTCAAA
TTTGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCTCGTCCTAATCACTGTTACGGCAGAAAGTGATG