Description :
From Genome Similarity Track
Location :
Scaffold_3177:4- 1320
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3177-snap-gene-0.0Reverse transcriptase

Sequence
1316 bases(100 bases per row)
CACCTCGTAGAGCGCGGCTGCATATACCGCAAAGTGCTCCACGAAATGATGATAGTAGTTCAGTGACCCTAGGAATGACTGGATCCCCTTCACGGTCTTC
GGAAACGTGAGCTTGACCAATTCGTCGAGATTCTTCGGCTTGGCCTCGATACCTGTGGCCGAGACGACGTGACCGAGGTAGTCCACTCGGCTCATACCNN
NNNNNNNNCGCATATACCGCGAAATGCTCCACGAACTGGTGATAGTAGTTCAGTGACCCTAAGAATGACTGGATTCCCTTCACGGTCTTCGGAAACGNNN
NNNNNNNCTCACACGCTTGGAGCAGCCGCTCGAGTCGTTCACACATCTCATCCCACGTTCTCCCGCCGAACAAGATATCATCGATATAGGACCGACGCCC
AATTGCCGACCGCGTTTCGGCTCCAGCCGGCTTGCCGTCTAGGAACACGTCAGCCTCGTCCTCCTGTAGATGCTTAGGGGTCAGCTTGAGATAACCGTAG
AGTGCATTGTCGAGAANNNNNNNNNNAGACCGACGTCCAATTGCCGGCCACGTTTCAGCTCCAGCCGGCTTGCCGTCCAGGAACACGTCGGCCTCGTCCT
CTTGTAGATGCTTAGGGGTCAACTTGAGATAGCCGTAGAGTGCATTGTCGAGAAGGCGTTGATAAATTTGCGGTGCGTTGCGCAAGCCGAACGGCATCCT
CAACCACTCGAACAAGCCGAATGGCGTAACGAAGGCCGAAGTCGCCCGGGCTCTCGCCGTCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGAGTGCGCTCACCATGCGGTAGTCAATGCACAGGCGAATATCGACG
CCATTCTTCTTGACCACGATCACGATCGGCGAGACCCATGGCGACGTAGACGGCGCGATGAACCCTGCCTGAAGCAGCCCCTTCAACAACTCGTAAAGCT
TATCCACGAACTGCGGCGGTACCTTTCGACACGACTGGGCGATTGGCTTCGCGTTGCCGACGTCAATGTCGCAGATGACTCCTTTGGCAGGAAGCGGTCG
AGCGTTGCCGTTACCCATGAGGTAAGCTCGCCTGCGCCATATCATCTCACGTACTCGCTCAATGTCTTCAGCACTGACGTCCTCTCCTGCCGAGATCTCG
ATGTCGGCCGGCGTGATGTCCTTGTCGGTGAGCGGCACCTCGGGTATCATCGCCATCTGCCCTTCGATCTCCTCGGCGCTGACGTCTCCACCCTCGTGTA
CGAACANNNNNNNNNN