Description :
From Genome Similarity Track
Location :
Scaffold_1637:4- 1318
Transcript NameFunction/comments
Phyta_totarag13397hypothetical protein PHYSODRAFT_332751

Sequence
1314 bases(100 bases per row)
TTGCTGATCCACCCTCTTGCccgatcttcatcttgatcttTCCCAGTGAACACCTTCAGATCCAAGATGGCTGAGATCCGCACACGTTGGATGAGCGCGG
ATCCAGCTGATCTAGCCGTCGTTGTGGCGACTGCGGCACGAGTGGGTGGAGCATCAAGATCGTCGGGGTCGTACTCCCAGAGAGCGGGGTGATGGTCGGG
CGATCCGACCGACTCCATGTCCACACCTTGTGTGCCAACGTTCCTTGTAGTGGCCGCGACCGGGGTTGGTGCCACTACTTGCTGTTCCTTGAGGAACCGG
CTCATAGCAGCTTGAGAATACGATTCCAACCTGCCTGTTGGTTCTTCTGACGAAGTTACATTCGTGATCTGGTTTGGCTGCCTCTgcggcggcttctgct
gTCGCGACAGCGTCCGATCCGGGGACTTCCCACGTGATCGAGATCTCACTAGAGCTTCTCTAGAAGGTCCGAGAGGCATTGCGTTGCGGCCTTATGGATC
TATCGGAGTCTGGTTCTGATGTAGCCGATGCATAATGTGAAGAGCCAGTCTGGCACTCCGTCGTGCTGATCTGGGGCGAGATCTCTCGATCTTTGATCCG
TGCATTTCCGCCTACCAGGATTGCTAACCTAGCGAAAAGCTCTCGGGAAGTAGATTTGACGGTCTCTAGGTCCAGATCAAACAGTCCGTCAGCGTCGAAA
GCACCATCAACTAGACCTGCCTCCTTCAGCATCTGGAGTAGGTTCTTGACCACGGTCAGCTTGTTGGACGTTTCTGGCGGAACTGACACTGGTCCCTTCA
GATCTCCGATCTGCTGTACTTTCATAATCTTCATTACTGGATCTTGGAGTAAGAAGTCGCGTAGGCCTTGTGGTGAAACGCGAACTctagctgctgctcg
gccCATGCAGACGGAGATTCCTTCTGACCTTCGCCATCCGACTCAGGtgccttcattttcttccaCGTAGTCTtcggtttcttcttcttcgtatTAGATC
TGGCGACTAGCGGGCTTGCGGTCACTTCGTTCGTCAGGAACGCATACGGTTCGGGTTTAACCTTACCGGTTTTGTTTTGCGGATCTCGATGCGTATCGAG
GTCCGCTGGGAGACCTGGGGAGGAGGTTGAGGTTTCTCTTCTAGATCAGTTTCCAGATCTCCCTCATTTCTGTCGACAGAGTTCCTCCCAGTCCTCTGCC
GATCTGTGGATCTTGCTTAATTCAGCGGCGTTGCCGTCGATCCAATCTCCGATAacgcttgatctccttgttcttcttgcaTCTTCACATCTTCTTGGGA
CTCACGGTGAAATC