Description :
From Genome Similarity Track
Location :
Scaffold_4291:4- 1313
Sequence
1309 bases(100 bases per row)
CGTCCCATCCCTGGCTCCGGGCTTGGCACGGTAGAATGCTTCAAATGACGTCACACTGCTCTCTGGGCAAAGGCCCATTCCCTTGTTACGCAGTATTTGG
TTTCCAGGAACCAGCTCAATCTCATGACACACGCCTCGATCCGGAGGCAGGCCCGTCGGTGGGTCTTTCGAGACAACGTCTCCATACTCCTTCACCACCG
GGTAGAAGGGATCCGAAGGATCTTTGAGGATCGCCGATCCACTTCTTGCGCTCAGCGCCTTCTTAATGTCCTCTAGGACCGCGTCGTCCACGACGGATGA
GGAGTTCAACTCCTCCTCAGGTCCCAGCAGGACCACCTCGGCTAGCTCGCCTGTCTTTAAGGCCTTGCCAAACTCGGCAATGGACATCTCGTCCAGCTCT
AGCAGAGCATCTGCAGCGGGCAGAGTGGCAAGGCTGATATCGCCTTCTACCTCCCCCGTCACTCCGTTAGCGAGTGTATACAGCTGTTCGCAGCAAGCAC
GTGGAGCATCACCGCTCGACACGTTGGACCACGTCCGACGTCAAAGACGTCACAGACGCCCTGCGTCTTCTTCTCCTCTCCCTCCGCGACCGAGCCCGAC
CGGATGAGAGCGGTGTGGCGACATTTTTATCACCACACCGGGTGCAGCAGCACCATCACTCCTCGAAGAGGATACAGTGTTTCGCAAGACACTCGGCTGA
AAGCCAAGAGGTTCTTGACCTTCACACAGTGAACTAGGTGTCACTTCACCTGCATCTCCTGGGCCACGCCCATGATGCCTCGACTCGCAGTCGACGCGAC
CCTCGGGTCACGCAGCGGCAGGTCTTTGACCAGATTCGTACACTCAGTGGATTACGCGTCACTCCGCGCTCGTCCTCACCAGGACCCAGCAGTTGGTCAT
TGACCTGACCTGCAACGCTCAGCGGATAACGTGCCGCACCACGTACGCCCTCAGGGCAAACAGCAACCTCGTTGCTAACAATTTCGGACATACCAATGTC
CAGCACTACGGCCGCCTCGGCCTCGTGCTCGCGCCAAAAGCGCTTCTGCTTCCCAGCAGAGGTGGGTTTATAACTCACCAAAGCTCCACTAGGAGCGGGG
TGCGACGCACCTAGCGTTTTCGACTTCCAGTCGATCCATGGCTCATGGCGTTCCAGCCATGCCATGCCAAGGATGAGGTCATACCTCGCATCCAGGTCTA
AGACCAAACAGCGTTCCACGCTATCAAAGTTCTCAAACTTCACTCCAAGGTCGACAGAGACCTTCGACACAGTTACCAGTGTCCCCGTCGCGAGACGGAC
AGAGATCGT