Description :
From Genome Similarity Track
Location :
Scaffold_3809:4- 1276
Sequence
1272 bases(100 bases per row)
AAAGGAACTACAGTATTTGCGCTATCGATACCTCTGCATGTGTGCGTAAGCCTAACTAGTTAGCAATCGTTTTACTTTAGAAAAACGTTTTTGAGTGCTA
AGTTGGATCCGCTGTGAACTGAGTACATTGAAAGCTTTGCGCGCTTCGTCAGATTCAGAGTCTTAATATCCGAGTATACGCGCTGGACACGTATACTTGT
AGCGCGTTTCCTTTGATTGCACAACTGGACCTTTATAAAGTCGGGGTCCGTCGGGCATCCGTCGGGTTGGGTCGGGCAATGTAGCCTGACTCTTTCACAT
CCGTCGGGCTAGATAACGAGTGCCTTCTATCAAATCTCTAAGAGCACCTCCACCGGTATTGTGTATTGCAAAAGTAATTATCGAGAGTAAATCGGGAATT
GGGCCCCAGAGTGCATCATAATGCAAACTATAAGTCACCTATAGAAAAGCAATGTCATCAGCCAATGGTTGGCTTTGGACGACCTTGGTACCTTGTACCA
AATATCCCGAAGTATGACGTGTCACACTTCATGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTT
CCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACAGGATCCAGTGACCAGACAAACCTTAGGTGGATCTGCAGTG
ACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAGTAACCACGTGTCTCTCCTCTTTGTAGATCCAGGGTTGAAGAGACTTTGG
ATCTGGAAAACTCGTCCACTTGGCGCAAACTAGAGACCCTGGCAGCTGAAGCTTCCTGTAGAACCACGTGAATAATCGACTGGATCTAGGGTCCTGTTAC
CTGGATCTAGCGATGTCTTGTTCACAAATGCCATAAATGGCAGTAACCTAAAAAGCTCGGGCTCGCTAACGGAAATCCAAAACCCGGCGAGCGTCCCTTA
GTTTAACATCTTCTCTGCCACTTCCGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTC
CCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGC
ATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCTC