Description :
From Genome Similarity Track
Location :
Scaffold_1439:4- 1262
Sequence
1258 bases(100 bases per row)
ACTCACGTTGCACGCGCTGACTGTCCCCACCTGTCGGATCCAGAGTGGGAGGCTCTCCAACGACTGTCAACAGTCATTGGTGAGGCGGCTGTAGCTACGA
TGCTGCGTACGCTAACGCCGACAGAGCAACACGGTGTTGCTCTGGGCTTCATCCTGAAGGAGCAACGCGATGTTGCTGCTACTACCGCGGTGCCGTCCGG
GACGACATCACGCGCGCAATCGCTGAAGCTCAATGTGAGTAACTATGTCGGAAGAGAGGGTGAACCCCTCCTCCGTTGGCTTGTCGAACTCGACACTGCC
ATTGCGGCTCGACGTATCGACGTATCGTCGACCCGTTGTCGAAGGTCGCGTTCGCCATTTCATGTCTTGGCGGACGTGCAAGAAGTTGGGCGTATGGACG
CCGACTCTCGGATCCTACGTGCTTTAGCACGTACGAGGGTTTCACGGAAGAGCTCAGACAAGCATTTGAGCCCCCGCAAAACGAGTTCCGGTCGAGGGCG
GAGTTCCTCGACCTGCAGCAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGAGCACGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGG
CGACCAAGGTCGTCACGTTCATGAAGGGACTGAGAGATTGGCCTGTGAAGACCAATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATCACCCT
TGCAATGCAGGAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCCTGCACATGTGCCGAGGCCACAGCCACGCCCGGTAGTGAGGACGGGAGGCCCCGAACCC
ATGGACCTCTCGGTGCTCGGGAGTGCACGGCCCCCGTGCACCAGCAGGGTGGCTATCGCGCCGGTGCCGGGCACCGTCGCAACCAAACAAAAAACGCTGG
ACGCCAGTAGGCGCGGGGCGCCCTACTGGTAATGCAGTTCCGCGTGTCGACCTTGGACACGCGACACTGAGGACTGCAATCCCCAGTGAGATTCATTCTC
GGTGCAAGAACCAAGATGACAAGCAAGACCTTGTCATCCTGAACGTAAACTCGATGAGAGCAAGCAGCTCTCTTCGCGCTTTGGTAGATTCTGGCGCGTC
GAAGAACTTTGTTCGACTGCGAAGTCTATCGAGGCTTGACTTCGAGGATCTAAAGATACCTCGAAGTATGTTGGAGGTACGACTGGCAACGGGTGCCGTC
GTGAAGACCCAGAAGCGCATGGTACGCGTGCGCTTCACGTATGAAGACCAAGAGTTTG