Description :
From Genome Similarity Track
Location :
Scaffold_1781:4- 1247
Transcript NameFunction/comments
Phyke_g12133hypothetical protein PHYSODRAFT_555569

Sequence
1243 bases(100 bases per row)
AACTCTTCGCTGTTGAGGAACTTGTTGAGCATATCCAGAGCCACCGCCGGTTGATCCTGAGGCACCATGTGACCAGAGTTGAACACGCGCAGGAACGTAA
ACTGGTTGTTGAACGACCGCACCACACCAGCATTCATGCCTTCACCAGTGATGAATGCAGTCTCAGGAGCGGCGTTGAAACCCTCCTTGCCATTCCAATC
CAGCGCCAGAGTCCAGGCCTGGTTGCCGTACCAGTTGCACATCAGATCCGCGTCACCCGCGTAGATGAGAACCCGGAGACCATCGTTCAGTAGGTCCGCC
ACGTACGAGTTGAATGGCTTGGCCATGTCGGCTGTCATGTAGAATGCTTCGTTCACCTTCATGTTGCACTCCTGCCACGCGCCCACACGCTTCGAGTCTA
CGCCTAATGATGCTCGCACGTTCGGGGCGTCCAAGTACTTGGACACAAACGACATGTCGTAGCACTTGGTCGGGTCGTCCATCTTGTCGCACGGCATGCG
AATGTCGTACGGGTTGCGGTCGgcagacagcagcggcatGAACAGCTTCTCCTGACAGAAGTCCGTACCATCGAAGCACGCCGACATATTCTGCGGACAC
TGTTCGAGGATAGAGCTGCACAAGGGGGCGGCTTCCTTCATGTCCTGCAGCTGTGTCTCGTCCACGAGCGTGATGTTGTACGCGTTCTCGACTGCCATGT
CGATGTAGTGTGGCAGTTGGATCGAAGCCTGCGTGATGCCGTTGCCCACGGCGATACCCTTAAGGTTGATGTACTGAGGCGTGCcgacgttcttcttgtt
catctGCCAGACGTAGTGCGCAGCCACTGGTACGTAGTGTCCGCCATAGCTCTCACCTGTGATGTAGAAGTCTCGGTTCGCCAACTCCGGGTGCTTCTTG
AAGAAGCCCTGCAGGAAGTAGTAGATGTTCTCGCCCACATTGTCCTCACTATTGTCCGCATCTTGTTTGTCGCCGTAGGTAAACCCTACAGTTGTGGGTT
GGTCCAGCCACACTACGTTGCTCTCATTCGTCCACGAGTACGTGTTGATGCGCGTTGACAGATCTGGCAGCACGTGGCACGGTCCATTCTCGGTGAGCAG
CGCCATCATGCTGGAGCATCCAGGTCCACCCGTGAGCCAGAGCACCAGTGGGTCTGTACTGGGCTGGCTGCGCGACTCGAAGTACCAGTAGAAGTAGTGG
TCGTCGATCTTGTTGGGAAGCTTGATGTAACCTGAGTCTTGAG