Description :
From Genome Similarity Track
Location :
Scaffold_4396:4- 1207
Sequence
1203 bases(100 bases per row)
ATAGCCTGGCTCCCGATCATGTCTAATCATCTCGCTAGCTCCAAATCTACGGAAAACGCACTCCTCGTACGATTCAGCAATGGTTTGCGCAGTTCTAGAC
GCACTAGCTTTGGCTATCACGTATCCGGTAAACAAATCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGAGCAGCGAGGGGATATGATCCA
TGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACGCATTCACC
GACATATCGTTGTACGCTCTTGAATAGTCCTCTCCAGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAGGCTA
GCATGGTAGTGGTGTAGGCCATCCTGTTGCAAGGTTTCTGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGGCAAT
AGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATACTGTAGGATTTAGTATCCTCCCGACTCAGGTCTCGTACATCCCCCATCAGATA
CTTCTTTAGTCCCAAGATCCACGCTTCCTCGTTTGGTACTTTGAGGATCCGCTCAATACGGACTCCCTTCACAAATGTTTCCTCGAGGATCTGGGGGCTG
GATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGAACTGTCCTTTTCCCGGATCCCACAACCACCACTTCGTCTAGTCGGCTCAACGTAACGA
GATCCTGATGCTCGGCCTTTCTCTCCACTTCGACACCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTGTCTGCACTGGCATTCCAATCTCGCTTGAC
ATGCACCAACTCGTGATTCAACCATCCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCGCCTCGCACC
TGTCTGATTACCAAATTTGAATCCCCACAAATCACCAGCCTTTTTGGATCTTGTCCCTTTAGTAAATCCAAACCCAGAAGGAGTCCGTTATACTCCGCCT
CATTGACGGTGAGGCCTTCTGCGTAAGTGGATCTGGCTCGTACAACTTCCCATCCGGGCAGTCTCCACAATAGGTGCACTGTATGCTCCTCCTCCGCGTC
GTA