Description :
From Genome Similarity Track
Location :
Scaffold_1813:4- 1202
Transcript NameFunction/comments
Phyke_g12161hypothetical protein PHYSODRAFT_485789
Phyke_g12162hypothetical protein PHYSODRAFT_488333

Sequence
1198 bases(100 bases per row)
GGTTTCCATCACTCGCGTGCTCATGTTATACTGTGATGTTTGCAGACCTGAGCAGGAGTAAAAGAGTGCAGTTGCAAACACCCGAATCTTcgtctgtgtg
tgtgaatCAAACATTTCCAGCGAAAGAAGCGACACCGTTTTAGCGGGACCATGGCTGCTTAAGACCTTCGAAACTTGGTGGTCCTCACTCGGAGTATTGA
AGACATACGCGAAGGCCTTGTTCGTTGCCGTCATATTCCAAGCGCCGCGATCAAAAATCCACTGGGCACTGAGACCTGCACTGTTGGCGTGCTGCGCGCC
GCCACGTCGAAAAGAGTGTGACGTGAGACGCTCAGTCACGCCAGCCTTCTTCCCAATCCGGTCAAGAACACGATTGACGTAGCTATGGACACCAGGCGTG
GTCATTGGGGCCTTGGCAGTCGAAGTGTCGGGCGCAGATTGTGCCAGTAACATTGTTTCTGGATGATCTAGCAGGTCAATCAACGGGAAGGATGGCGTGA
GCTTGGCAGATGTAAGCAGCTGCTGATCCGGAAGATGGCTCAGTAGAGCAGGCGTCGGTGACGACTGGGTAATCAATGCGAGCGCAATAGCAAGTATCGG
ACAGGTTGCGAAGTCGTCGTCAGGGAAAAGAGATAGTCCTTGCTCTTCGGCTGTCTTGATTCGGATGAATCTTACAAAGAAGATGTCGCCTGAGCCGATG
GATAGGTTAGACTTGCGAAGCAGTGTTAAATCTGAAGCTCGGTCAAAAAGGAACCAAAGCAGGCATAGTAGCGCCGCATCTTGATAATCAGCCGCCATGG
AAGCAGTAGAATACAAATACATGACCATTTGCTTGAGTGCCTTCTTCGTACATGCTGGAGCTTTATTGACAAAGCCTCCAGATTCGCGCTTCAAGCAGTA
TCACTCTAGCGTCTGGCCCTTCTTGAGCAGACGCGCATCGACAGCGGCATGATGCTGCGGGAACTGATCCATGAGCCAATTCTTCGCCTGACGGAAGTAC
TGCATGACCGAGTGGCGCGCTAGCAGCTTCCCCTTGCGACCCTCCTTGAACGCCAGATGCATGCCAAACTTGTCCACTACCGTTTCCAAGATAAGTGGCG
CGTTTTCACGCAGCATGCATGTCTTTAGATACTCCCAGctcatttcttcttcttctaagAACTTCATGAAAGAGCGCGCCGCGCTGTCACGAGCACAT