Description :
From Genome Similarity Track
Location :
Scaffold_1399:4- 1193
Sequence
1189 bases(100 bases per row)
CAGTTTACAGTTCGACAGTTGATTTGGTGAAGTTAAATGTATTTAAAGTAACACACGAGATCTTCGGCATTAATCTCAGTGTCAAATCTGCAGAGAAGAA
GGAAACGAGAAAGCCTCAGCGCAGTTGAACGTAGTAATAACAAGAAGCTGATCTAGTATTTTTTTTATCTTACTCGCGCTGCTAGCTCTCGACATCCAAT
AGAGTTATGAGCCCAAGCAAGTCGTCGTAGGAGGTTGAGATGTAGGAGAAGACCGGTAGCCTAGTCCGATGGATCGGACAAATTTGGCCATACTATCAAA
GGTTGATGGATCTGGTATTCCACCAAGAAGACGTATTTCGAATCGCTACAGGGGCTATGGTGCGCGATCCAAATTGGACCCAGGTGCAAGTATCTACTTG
GGAGGATAACCAAAGAACTGTACAGCGATTGATATTCGCGTCAGTTAACACGGATTTTGGTCAACAGCTGACACACAAGACCTATGGGACGTCTATGCGA
ACGTACCTATGAAATAGATTTGATGGTACGGTAATTTACCAGACTCAAGCCCTAACGAAGCGACGATTGTACGCAGAACTGGAGGCTACAAGATGCAGGC
GTAACAGCGATATTAAAGGACATTTAAAAATATGATTCGACTGCTCACACGACTGTAAACGGTTGGTATGACACTCAATGACGCAGTTTTTAGCGGGATG
CTAGTGTCATCTCTTCCTGCGGGAAACGATCCAACCGATTGCGTGGTTAAGTAAAGTCTATAATTGATCACTTCCTGATTTGCAGCCTAACGCACAAGCG
ACTCTTCGGCTGATTAAGTCATCTTGTAAATGTGCCACACAAAAAACCTACAAAGTGTGATTTACTTCGCTGCCAGTTACTATGACTCGAAAGCAACGCA
CAGGATAGCATCAGTCCACCGCCTTCGCGCATCGGAAGAAGACTGATTTTGCTGATGCCATCGCCCAAGGAGACCCCGGTGCTAATGTGCTGCGTTTTCG
GACCCGATATCGCATCAGGCTGCCGTGGAGCCTTCTCTCCAGTCGCCTGCGTTTCAGCCGGGAGCCGCCAGTGGTGTTTCGTCTTCTGCACCACCGGTTA
CTGCAGAGTCCTGTCCTCGTAGCCCTCCTGTACCGGCTCCGACTTGGTCCAAGGCAGACATTTCCAGTCTTTTCGCCAAAAAGGACCCA