Description :
From Genome Similarity Track
Location :
Scaffold_3918:4- 1192
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_3918-snap-gene-0.1Amino Acid/Auxin Permease (AAAP) Family

Sequence
1188 bases(100 bases per row)
CTGCTGTGTCTACGGCATTGGTACGCTGGGCATGCCGTCCAACTTCTCGCGCGCGGGCCCAGTGATTGCGATTATTGCAATGGCGTTCATGGCGTTCGCC
AACATCTACGCGTCGGTCGTGATCTCCAAGGTCATGCTTATTGCACCGCGCTCGGTCAAGACGTACAGTGATCTAGGCGAATGGTGCATGGGAACTACGG
GCCGCTGGCTGGTGCTTATTTTCCAGATCGCCTACTGTTTGTCGATTCCATGCGCCTTCATGGTGCTCGGTGGTACTCTGCTCGAAAGCTTGTTCCCAGG
CGCGTTTAGCAACTCGACATGGATCATCTTGATGGCGATCATGGTGCTTCCAGTGTGCTTGATCCCAACGCTCAAGGAAGGTGCCGGTGCTGCGTTCGCG
GGCTGCATGGGTACGCTCATCGCCGACATCATCGGCATCGGCCTTCTCATGCACGGAATGAGTGNNNNNNNNNNNNNNNNNGAGCGGCCACCCTTCGGTG
CCTTCCCCAGACCTCTCGTTTAAGCAAGTTGCCAACACGTTCGGCAACCTGTCGCTTGCGTACGGAGCCGGTATCGTGATCCCAGCTCTCCAGCGTCAAC
ACAGCGACCCAACGCGCATGCCTCGCGTCGTGTTCGTTACTGTGACCTTCATCTCGTGTCTGTTTCTCGCGCTTGCTAGTTCGGGCTACTCGGCGGTCGG
ATGCCAGATCTCAGGCAACTTGCTGTTCTCAATCTATCCAGATGCTACGACGGGCTTGTCCAAGCTTGGCTTTCGATCGGACCTGGGCATGTCGGTGCTC
GCGTACCTGTTCATGCNNNNNNNNNNNNNNNNNNNNNNNATTACGATCGCGTACGCGGTGATCTTGCACCCGGCGTTCTACGTGTTTGAACGCGTGCTGT
TGGGTATGCACAAGAAGAAACCCGAGGACGACATTGAAGCGCTTCACTACAACGCTGTGGAAACGCCGTCGGGGGTTCGCAGTGACATGAAGTCGCTTCA
GTCAAAGGGCTCGGTGATCTCAATGGCCGATATCGAGAAGGTGTCACTCAATGATGAAGAAGAGGCGATGGAGTACCGCGGAGCGAATGCACTCAAGTAC
GTGCTCCTCCGTGTCGCTATCATCGTCGTGCTCGTTGTTGTCTCCGTGGTCTTGCGTGATGACTTTTTGGACTTGCAAGATTTCATCG