Description :
From Genome Similarity Track
Location :
Scaffold_4051:4- 1168
Transcript NameFunction/comments
Phyta_totarag15618hypothetical protein

Sequence
1164 bases(100 bases per row)
GAAGGAGTCTGGAATCATTGCGGGCGCGTTCGAAGCtgacgagctgttcgacCTAAAGCTTGGCGAGATCGAACATGCTCTCAAGACCCTCTTCGAGACG
CTGAAGCCCCTGGTTGGCACGATCAGCCAACCCACCAAGGAGATTGTGAGATCACAGCCGACACTCGCTTCGGACGACCAGACTGGGACGTCGTCGCACT
ACGAGTCGGTGACTGAAGAAGTAGACTccgacagcgtcgatgaCCCGCCAGGAATGACGCTAGGACCATCCGGTGCCGCCATGCTGCGAGATCGAGCTGA
CCGAGCTGAGCGCGAAGCAGTACCTTCGGCCCAAGAGACGAAGATTGCAGTAGTGAACCCGACACGTCACTCGCCAGAGAGGCTGGAGTCGTACTTTCAA
TCTGTGATGGGACGCTTCTTGAAGGAACAACAGTCCACACCCCGTCCACGTGTTGCGAGACagactggagatcaagaGGTAGTGATGGAGTCGGCTGGAT
CGCCAGATCACCACTCCTCTCCATGGGAATACGATCGCGACGACCTCGATCTTACCACGATTACTCGcgcagtggtggcggcgacagcaacttcacaGGC
CGGAAGATCGACCGCCGCTCCACGCATCCGCGTGTCGGCAATGTCCGAACTGAAGGAGTTTACCGGAAAGGAGGGCGACGAAGATCGAGCCCGGTCCTGG
ANCGCCGCTGGAATACTTGCACCGTCTCAACGTAGCTGGGCTCCGTGCACGTCTCCAAGTAAAGGATGGATCTCCGGAGACCCGACGTGAAGACGTCGAC
CACTTCAtcgagacgctggacgaTCGTGATCTCGCCGACCATCTCGCCCTATTGCGAATCCCAGATGCCGATACcctggaggagacgcttcGATCTCGAC
AGCGTGCGAAGGCGCGTCAGAGCAAGAACGTCTATGGATCGANACCAGCAAGATCGACATACCAGATCGACTGACCTGGGGACGTCGTTCAAGCGCTGTT
CACACTGCGGGTCGCGCATGCATACCGATCTTGGATACTGGGAACGCTTGACCTGCGAGAAGTGTGGCCGAAAGAGGCATCCATCCGACTGGTGCTTCTT
GTGTGCAAGGCCTGCGGTGAGATCCACGACGCTGGCCAATGCCCGATGGAGGAGTTCTACGGTC