Description :
From Genome Similarity Track
Location :
Scaffold_133:4- 1137
Sequence
1133 bases(100 bases per row)
atgtggtggtttgttagagccaaacaaaagcggaacacgtcgtcatacagctctctgctccaacgatacttgtctgacgtaattcaccaaagttggttta
gtcgaccgaaaaagttctcgacaataacacggtcgtgggcgatgagatcgttcgttgcttgatctgcacggctaagtgatcgcccttattttttcgggtg
gatgcaacgaggtgagctgctattccttggtaccctttatccgcaaggattgcccattcgctcgggaaggaatcacgaagaggaccgttatcgttcaatg
attcgtcacctggtagcttcttgatcttgctgaggtggaacgtttgttgttcttgaacatcgtgatgtcgtgtatcgacccttttgcgtgttcagaacaa
ttgatagcgaatcctcgtttatcgatacttctactttgaggccgtacaagtactgtaccatgaaccattctctgcgattgaaccgccagggcgctagctc
tgttggaacgtgacgtctactgcatccagtgcacacggaaagttgtcaaatacgtttccagttgtagatgcagtccgcatctttaattggccgcagcggt
cttccacttggtcgacatacaactttggcgccagtatcttgatgaacttgaacaccacattagtaaacgtagtggttggtagacgaaacagttttgcgtt
gttgtcccaggtccctccctctttgagcacgactaatgtcatgaaaaatgcgtctttaggtttgacgtctgaccgttttccccttccaacaccgtagttg
gcaacaacgtagtcgcgtacggtaacccacagctcgctaaactcccgttgcgtaaagttagtcttctctgcgatagcgttcgcccctccgaactcgcgaa
acgggtccaggactggcgtgtcggactcctcggcgtcgacctcgtgcgggcgagtagtcgggtactgtccgatgtcttgatcacgctcgacccgtcggtc
caaaagctcctggagtaccaactcgaccctggttcgatccacacggcgggtagtggacgtcgtttggcgcggcattgtaaatgacttagtcttttatgta
gggctgaacaagattgagtaaattcaaaaatga